1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artyom0805 [142]
3 years ago
9

Which list of atomic model descriptions represents the order of historical development

Chemistry
1 answer:
Ilya [14]3 years ago
5 0

Answer:

percocets

Explanation:

deals wit pain help with healing

You might be interested in
Two firefighters are trying to break through a door. One firefighter is heavy, and the other is light. If they run at the same s
liubo4ka [24]

Answer:

the heavy one

Explanation:

the heavy one because heavy things and break things and the light one can't

7 0
3 years ago
Which statement is true about air temperature and humidity
lapo4ka [179]

Complete Question:

Which statement is true about air temperature and humidity?

Group of answer choices.

a. the air temperature does not affect how much moisture the air can hold

b. hotter air holds less moisture than colder air.

c. hot air and cold air share the same amount of moist.

d. colder air holds less moisture than hotter air.

Answer:

d. colder air holds less moisture than hotter air

Explanation:

Weather can be defined as the atmospheric conditions of a particular area over a short period of time.

The elements of weather include precipitation, wind, temperature, atmospheric pressure, relative humidity, cloud, and wind speed.

Temperature can be defined as a measure of the degree of coldness or hotness of a physical object (body).

On the other hand, humidity refers to the concentration (amount) of water vapor that is present in the air. It is high when there's a lot of water vapor in the air and low when the level of water vapor is small.

Hence, the true statement about air temperature and humidity is that colder air holds less moisture than hotter air because as the air cools, its molecules move closer together while the molecules move farther apart as the air become hot.

Additionally, at constant humidity, relative humidity is inversely proportional to temperature i.e as the temperature decreases, relative humidity increases.

6 0
2 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
HELPPP<br>yall please help my sister won't help me ​
ira [324]

\text{H}_3\text{PO}_4  + 3\text{KOH}  \longrightarrow \text{K}_3 \text{PO}_4     +3\text{H}_2 \text{O}\\\\10\text{Na} +2 \text{NaNO}_3  \longrightarrow 6\text{Na}_2 \text{O} + \text{N}_2\\\\\  2\text{H}_3 \text{PO}_4 + 3\text{Mg(OH)}_2 \longrightarrow \text{Mg}_3(\text{PO}_4)_2+6\text{H}_2 \text{O}\\\\2\text{Al(OH)}_3 + 3\text{H}_2 \text{CO}_3 \longrightarrow \text{Al}_2(\text{CO}_3)_3 + 6\text{H}_2 \text{O} \\\\2\text{C}_6\text{H}_6+15\text{O}_2 \longrightarrow 12\text{CO}_2 +6\text{H}_2 \text{O}\\

\text{Pb(OH)}_2 +2\text{HCl} \longrightarrow \text{PbCl}_2 +2 \text{H}_2 \text{O}

2\text{Mn} + 6\text{HI} \longrightarrow 3 \text{H}_2+2\text{MnI}_3

3 0
2 years ago
Does sodium fluoride follow the octet rule? If not, which exception is it?
krek1111 [17]

Answer:

Sodium fluoride (NaF) does indeed follow the octet rule without any violations.

3 0
1 year ago
Other questions:
  • Hno3 is an Arrhenius what
    15·1 answer
  • Why does air exert pressure?
    8·2 answers
  • Similarities between pluton and pegmatite
    7·1 answer
  • What is the full form of DNA​
    8·2 answers
  • Carly lives in an area with temperatures that are always very warm. Carly also lives in an area that is close to the equator. Wh
    8·1 answer
  • Write the molecular formula for the following compound.<br>​
    9·1 answer
  • Some one please Help and Thank you <br>​
    6·1 answer
  • How to write the ionic formula for the K1+, MnO41- pair of ions
    5·1 answer
  • Yeast cells thrive on ice cold water *<br> True<br> оо<br> False
    9·1 answer
  • Help Me Please , I'm hopeless
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!