1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katen [24]
3 years ago
8

Mammalian erythrocyte lacks nucleus. Why? Give reason. ​

Biology
1 answer:
faust18 [17]3 years ago
4 0

Explanation:

Complete answer:

A mature erythrocyte lacks nucleus and mitochondria so as to make a place for the accommodation of more hemoglobin and hence more oxygen molecules. Lack of such organelles also provides the peculiar biconcave appearance of RBCs that aids in efficient diffusion. Young mammalian RBCs are nucleated.

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
How often two genes cross-over can tell us how far apart the genes are from each other. this is called recombinant frequency (rf
Roman55 [17]

Answer:

By finding recombination frequencies for many gene pairs, we can make linkage maps that show the order and relative distances of the genes on the chromosome ..

6 0
2 years ago
Need help on some questions!
Annette [7]
I think that 3 is C and 2 is B
3 0
3 years ago
Which of the following best describes a new molecule of
meriva
It would be the first choice :)
Because when replicating DNA, this process is called semi-conservative
Hope this helps :)
~His Cookie Monster
8 0
3 years ago
Suppose the climate in an area becomes much drier than it was before. How would the plants be effected in terms of natural selec
Sedaia [141]
They were adapted to an environment and once it is taken away the plants will slowly start to die. I'm not 100% :)
3 0
3 years ago
Read 2 more answers
Other questions:
  • What type of relationship do the two species have.
    8·2 answers
  • What gas is changed by some bacteria into a form that plants can use? answers?
    8·2 answers
  • Global warming has been linked to a decrease in the
    7·2 answers
  • The lithosphere is a rigid layer made of Earth's entire crust and the very top part of Earth's mantle. This rigid layer is divid
    8·2 answers
  • In chickens, rose comb (R) is dominant to single comb (r). A homozygous rose-combed rooster is mated with a single-combed hen. A
    11·1 answer
  • Provides support for the cell, has two "suboarts"
    6·1 answer
  • Which of the following statements is a correct distinction between autotrophs and heterotrophs?
    9·1 answer
  • Submit your project researching some environmental problems caused by the agriculture and natural resource industry. Be sure you
    13·1 answer
  • HELP ASAP I WILL GIVE BRAINLIST!! Which of the following best defines the molar mass of a substance? (5 points)
    11·1 answer
  • Which organism is considered an exception to the cell theory because it has a noncellular structure?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!