1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katen [24]
3 years ago
8

Mammalian erythrocyte lacks nucleus. Why? Give reason. ​

Biology
1 answer:
faust18 [17]3 years ago
4 0

Explanation:

Complete answer:

A mature erythrocyte lacks nucleus and mitochondria so as to make a place for the accommodation of more hemoglobin and hence more oxygen molecules. Lack of such organelles also provides the peculiar biconcave appearance of RBCs that aids in efficient diffusion. Young mammalian RBCs are nucleated.

You might be interested in
In the figure, ΔABC ~ ΔDEF. Solve for x. Triangles ABC and DEF. Angles B and E are congruent and measure 160 degrees. AB measure
Andrej [43]
The answer is B. -> x=6.
7 0
3 years ago
Read 2 more answers
Questions are in the picture answer both plsss
vovangra [49]

Answer:

13. is Option J) all of the above

and 14 I'm not completely sure but I think its option D.

7 0
3 years ago
Is a mushroom a scavenger, a decomposer, a plant, it all of these?
stealth61 [152]
Although it depends on the breed of fungi, you're answer is going to be *C. a Decomposer*

I hope this helps! :)
8 0
3 years ago
In the human body, carbon monoxide reduces the amount of oxygen that can be transported to cells. Breathing in too much carbon m
nataly862011 [7]
I believe it would result in a decreased production of ATP molecules
4 0
3 years ago
During the timeline of a star. what comes after protostar?
yKpoI14uk [10]
Hi there!

The stage after Protostar would be - Sequence Star.

Hope this helps you!

~DL
5 0
4 years ago
Read 2 more answers
Other questions:
  • Which part of a sperm cell is responsible for providing the cell's energy? A. cell wall B. flagellum C. round head D. mitochondr
    8·1 answer
  • The inheritamce of a trait in humans is best described as being determined by ​
    13·1 answer
  • Which classification of drugs decreases inflammation and itching by suppressing inflammation due to tissue damage?
    6·1 answer
  • What is an important characteristic of the plant cell wall?
    8·1 answer
  • What forms the backbone of DNA?
    9·2 answers
  • If only one scientist has an idea, is the idea a scientific theory
    6·1 answer
  • What is migration? Give an example.
    15·1 answer
  • How does the sun power the carbon cycle
    15·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Put the following in order of size, from smallest to largest<br> chromosome, gene; base pair
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!