1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arte-miy333 [17]
3 years ago
8

Beriman kepada para rasul akan mendapat kebahagiaan di dunia dan

Biology
1 answer:
olga2289 [7]3 years ago
8 0

Answer:

Explanation:

Ndnds

You might be interested in
What happens when living things get in the dirt?
nignag [31]
Human exploitation of fragile ecosystems can lead to the droughts and arid conditions characteristic of desertification. Effects include land degradation, soil erosion and sterility, and a loss of biodiversity, with huge economic costs for nations where deserts are growing.
4 0
3 years ago
1 connection between mutations and reproduction
Helen [10]

Answer:

An organism's DNA affects how it looks, how it behaves, and its physiology. So a change in an organism's DNA can cause changes in all aspects of its life. Mutations are essential to evolution; they are the raw material of genetic variation. Without mutation, evolution could not occur.

Explanation:

6 0
3 years ago
Read 2 more answers
What conclusion summarizes an organism's ability to undergo fermentation?
myrzilka [38]
Fermentation occurs in anaerobic respiration, and produces less energy than in aerobic respiration due to the lack of ETC because oxygen is not present.
6 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Do animals have a crush on humans ?
nexus9112 [7]

Answer:

May be yes

Explanation:

They may have a crush on humans.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Help ASAP
    7·2 answers
  • The movement of ocean water is caused by several processes. _________ results in the continual circulation of ocean water on a g
    14·2 answers
  • The enterogastric reflex is stimulated by the presence of chyme in the stomach. is stimulated by the presence of chyme in the du
    10·1 answer
  • Genetic variation occurs when chromosomes are shuffled in fertilization and what other process?. mitosis mutation meiosis geneti
    14·2 answers
  • Plz help ;-;
    5·1 answer
  • All cells have _____.
    6·1 answer
  • What animals that grow naturally in the Pacific Northwest and Kitsap Peninsula ? please help
    14·1 answer
  • How does nature make its "natural selection"? (What decides which genes get passed on and which don't?)
    12·1 answer
  • What is a chemical formula? Explain and give an example.
    12·2 answers
  • Whats the answer ugh
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!