1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalija [7]
3 years ago
15

Cell drinking; cell eating. Both are modeled here and are examples of A) osmosis. B) diffusion. C) endocytosis. Eliminate D) fac

ilitated transport.
Biology
1 answer:
N76 [4]3 years ago
5 0

Answer;

-Endocytosis

Explanation;

-Endocytosis includes; phagocytosis, pinocytosis, and receptor mediated: Endocytosis brings substances into the cell, plasma membrane surrounds the substances to be taken in, encloses them in a membrane-bound sac (vesicle) and brings them into the cell

-Phagocytosis: endocytosis of large solid particles (“cell eating”)

-Pinocytosis: endocytosis of extracellular fluid that contains dissolved solutes (“cell drinking”)

-Receptor-mediated: highly selective, ligands bind to specific receptor proteins on the plasma membrane and are then taken into the cell

-Exocytosis: the reverse of endocytosis: substances are removed from the cell; vesicles fuse with plasma membrane and release their contents into the extracellular fluid; important in nerve cells to release neurotransmitter and secretory cells to release cell products (ex. digestive enzymes, protein hormones).

You might be interested in
Which statements accurately describe fermentation? Select two options.
Maru [420]

Answer:

fermentation is an anaerobic process

Explanation:

trust me

4 0
2 years ago
Read 2 more answers
Item 5 What is the role of a generator in producing electricity? The generator stores electrical energy for later use in homes a
Anni [7]

Answer:

The generator transforms the mechanical energy of the turbine into electrical energy

Explanation:

Electricity generator is a device that is used in generating power supply which can be used in industries, homes and for commercial and private purposes.

It operates by converting mechanical energy into electrical energy for the use in an external circuit. mechanical energy can be obtained from steam turbines, internal combusting energy, gas and water turbines and it can be obtained through the rotating shaft.

The capacity of each generator determines the amount of energy it can supply to a given place.

4 0
3 years ago
What is the difference between a jetty and a breakwater?<br><br> Why would they be used?
frozen [14]
Breakwaters protect an anchorage from the effects of weather and longshore drift, while jetties protect against erosion, by keeping the waves from sweeping the sand away. Difference, they both protect against different things.
5 0
3 years ago
What causes the repeating pattern of the moon's appearance(
Bad White [126]

Answer:

The rotation of the moon and sunlight reflection causes the different phases of the moon.

5 0
3 years ago
Read 2 more answers
Could someone help me please and thank you it’s timed
Mariana [72]

Answer:

electron transport chain

Explanation:

Im not 100% sure but this should be it.

hope this helps! :))

7 0
2 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • A diseased cell is no longer able to produce proteins. Which cell structure is most likely malfunctioning?
    5·2 answers
  • What is the biggest change in skull anatomy that occurred from the dawn horse to the modern horse?
    14·1 answer
  • Carlos is a healthy but sedentary college student. he weighs 175 pounds. about how many grams of protein should he consume each
    14·1 answer
  • According to the World Resource Institute, biodiversity is the variety of the world's organisms, including their genetic diversi
    10·1 answer
  • Cicada Killer wasps capture and paralyze cicadas by stinging them, and then fly with their cicada to their burrow. They drag the
    8·1 answer
  • While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that thi
    14·1 answer
  • Two interactions within an ecosystem are predation and parasitism. In predation, predator organisms feed on prey organisms. In p
    15·1 answer
  • What forms the structure called a coral reef?
    7·2 answers
  • What happened at the end of the most recent ice age?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!