1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TiliK225 [7]
3 years ago
8

Differentiate between new pond and old pond​

Biology
1 answer:
Aliun [14]3 years ago
7 0

Answer:

Ponds and lakes are both inland bodies of freshwater that contain living creatures. Lakes are normally much deeper than ponds and have a larger surface area. ... All the water in a pond is in the photic zone, meaning ponds are shallow enough to allow sunlight to reach the bottom.

Explanation:

Good Morning!

You might be interested in
Which best describes why scientists need to be creative? A. They need to be sure that the evidence backs up the conclusion. B. T
lisabon 2012 [21]

Answer: D, They need to think of ways to solve problems.

Explanation:

5 0
3 years ago
Which process makes diversity possible
Kruka [31]
Speciation, the evolutionary process by which new species are formed, is clearly responsible for the ultimate generation of species diversity over geologic time.
8 0
2 years ago
Explain how the discoveries by Rosalind Franklin
scZoUnD [109]

Answer:

In 1951 Franklin joined the Biophysical Laboratory at King’s College, London, as a research fellow. There she applied X-ray diffraction methods to the study of DNA. When she began her research at King’s College, very little was known about the chemical makeup or structure of DNA. However, she soon discovered the density of DNA and, more importantly, established that the molecule existed in a helical conformation. Her work to make clearer X-ray patterns of DNA molecules laid the foundation for James Watson and Francis Crick to suggest in 1953 that the structure of DNA is a double-helix polymer, a spiral consisting of two DNA strands wound around each other.

5 0
3 years ago
In a recent murder mystery, a woman died in minutes after consuming cyanide-laced sugar (glucose). Forensic scientists did some
AURORKA [14]

Answer:

<h2>Mitochondria was affected by the poison cellular respiration </h2>

<h3>Hope it helps you </h3>
6 0
3 years ago
what dk you call a group of organisms that are the dame species in an ecosystem? A)community B)producers C)population D)consumer
Assoli18 [71]

A group of organisms that are the same species in an ecosystem would be called a population.

4 0
3 years ago
Read 2 more answers
Other questions:
  • You discover a new species of slime mold that has a spore and stalk consisting of many cells. which group does it belong with?
    12·1 answer
  • Animals with back bones are called
    7·2 answers
  • Where does a zygote implant in a female after fertilization takes place?
    5·2 answers
  • What are some of the benefits and risks to consider with selective breeding?
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Which soil type have the largest pore space​
    10·1 answer
  • Oceanic crust is best described as _______.
    5·2 answers
  • Why do different colors affect photosynthesis differently
    7·1 answer
  • In all of these organisms, which microscopic structures carry out major life functions?
    10·2 answers
  • Which factor is a likely effect of overpopulation?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!