Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Humans come under mammal kingdom in vertebrates.
Humans may be called "naked apes," but most of us wear clothing, a fact that makes us unique in the animal kingdom, save for the clothing we make for other animals. The development of clothing has even influenced the evolution of other species — the body louse, unlike all other kinds, clings to clothing, not hair.2
The central and peripheral nerve systems are the main ones
Answer:
Their synthesis is considered to be discontinuous.
Explanation:
Okazaki fragments, which are strands of DNA that are produced seperately and then linked together, this is why their synthesis is considered to be discontinuous.
I hope this answer helps.
