1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AnnZ [28]
2 years ago
14

How are fish more complex than other organisms?

Biology
1 answer:
lys-0071 [83]2 years ago
6 0

Answer:

<em>Fish know how to breathe, eat,  sleep underwater they evolved swimming and only knowing how to swim. Some fish can temporally fly while others can see and live deep into the ocean. There are fish that know how to hunt while some know how to hide in plain sight. While in bodies of water there are fish that can be good for the environment and some that are bad. Some have scales some don't some have spikes and some have multicolored scales. </em>

Explanation:

You might be interested in
How long can a human live without food
cestrela7 [59]
Three weeks is how long a human can live without food
5 0
3 years ago
Read 2 more answers
if a deep-ocean trench is located adjacent to a continent, active volcanoes would likely be found _____.
horsena [70]
If a deep ocean trench is located adjacent to a continent, active volcanoes would likely be found landward from the trench. 
3 0
3 years ago
The use of coal and other fuels is the most prominent means by which humans add carbon dioxide to the atmosphere.
natita [175]
The answer is A.True but they are not the only ways in which this can occur.
5 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Different types of protists move in different ways. Describe how one type of protists you observed moves. Be specific.
Levart [38]

Answer:

Euglena is a protist and it moves with the aid of structures called flagella

Explanation:

Flagella are known as locomotive cells which propels from the body parts of organisms . They are made of protein structures and formed in a helical manner.

They are whip like structures and usually helps in the movement of the protists through liquid surfaces through the whip like movement of the flagella.

6 0
3 years ago
Other questions:
  • 13. What is an atomic nucleus? (1 point)
    6·1 answer
  • Scale coloration of lizards has a complete dominance relationship where green scales are dominant over blue scales. there are 1,
    11·1 answer
  • What makes get be a major difference between cells that are found in human cells and human nerve cells?
    15·1 answer
  • First-order (adaptive) changes are
    10·1 answer
  • How many times farther from the Sun is Uranus (distance = 19.20 AU) than Saturn (distance = 9.58 AU)?
    9·2 answers
  • What is the likelihood that the children in square 1 will have earlobes that are not attached?
    13·1 answer
  • The human race was traced to how many million years ago?​
    6·2 answers
  • How do cells get energy from sugar
    5·1 answer
  • Cells are the basic unit of _______ and______
    13·2 answers
  • A protein that is not integral to the plasma membrane and is often attached to the intracellular face is categorized as a(n) ___
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!