1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
3 years ago
8

Nuclear _________ reactions convert protons into hellum; thus, becoming the source of all energy radiated by the sun.

Biology
1 answer:
kaheart [24]3 years ago
6 0

Answer:

Nuclear Fusion Reactions

You might be interested in
1. Which of the following are functions of the nervous system? (Choose all that apply.)
xxMikexx [17]

Answer:

Maybe 2,3 points

Explanation:

1. receive stimuli messages from inside and outside the body..

2. responding to stimuli by sending messages throughout the body.

6 0
3 years ago
When a person is experiencing heartburn, he or she feels a burning sensation in the throat and midchest. Think about the structu
andre [41]
<span>The muscle at the end of the esophagus is not able to close, which allows stomach acid and digested food to go back up into the esophagus. </span>
3 0
3 years ago
Read 2 more answers
Microbes formed sheets that were able to capture layers of sediment, which formed the Earth's first soil.
Luden [163]

Answer:

Microbial mats.

Explanation:

Microbes formed sheets that were able to capture layers of sediment is called microbial mats. These mats of microbes provide good fossil evidence to the researchers. These microbial mats consist of bacteria and archaea which is considered the earliest form of life on earth. These microbial mats grow on moist places as compared to dry environment. About 3,500 million years ago, these microbes are the most important members of earth and maintainers of the ecosystems.

6 0
2 years ago
Scientists sink concrete blocks in oceans to create artificial coral reefs. Which successive event most likely occurs first on t
aliina [53]

Answer:P

Explanation:got it right

8 0
3 years ago
What is the importance of bees to producers
Ierofanga [76]
Assuming you are referring to plants when you say producers, bees help spread "pollen", or plant offspring from plant to plant, which helps to fertilize those plants and help new ones grow.
8 0
3 years ago
Other questions:
  • The synapse between which two neurons is a part of a monosynaptic reflex arc?
    7·1 answer
  • Acceptance of the germ theory provided the rapid development of which of the following:
    13·2 answers
  • A group of tissues working together is _______. A. an organ B. a cell C. a compound D. an organelle
    14·1 answer
  • I'm a newbie here an I have a question based on biology . Does all plants converts oxygen to carbon dioxide​
    11·2 answers
  • The cell membrane controls what enters and leaves the cell. Which of the
    5·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What process is a mechanism in plants
    11·1 answer
  • In what ways can geographic position be considered a temperature control?
    7·1 answer
  • I need help guys!! ​
    15·1 answer
  • What factors contributed to the success of the virus in 2012
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!