1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
garik1379 [7]
3 years ago
15

Pretend you are a plant. What characteristics do you share with animals? What characteristics are unique to you?

Biology
1 answer:
lana66690 [7]3 years ago
8 0

Answer:

you are a living thing like an animal

Explanation:

You might be interested in
I will give brainliest for the best answer
Hatshy [7]

Answer:

Scientists use the fossils around the new fossil to find its relative age.

Explanation:

7 0
3 years ago
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
3 years ago
Why is correctly performing mitosis important and if there is a error what happens to one or both cells?
Drupady [299]
If errors occur at any one stage, the cell can stop cell division from progressing
6 0
3 years ago
Read 2 more answers
The endocrine system is responsible for communication in the body using
Charra [1.4K]

Answer:

using your hormones as a chemical message to your brain

Explanation:

8 0
2 years ago
Which of the following are disadvantages of the Aristotelian classification system?
Kryger [21]
B  the system did not show relatedness of organisms.
4 0
3 years ago
Other questions:
  • In stage 2 of photossynthesis, NADP+ becomes NADPH by adding an H+. Where does the H+ come from?
    13·1 answer
  • The first organ that sperm pass through is the __________. the first organ that sperm pass through is the __________. epididymis
    11·1 answer
  • How is carbon stored in the biosphere?
    12·1 answer
  • Help please....:)
    12·1 answer
  • What water cycle obtains water?
    13·2 answers
  • Which list places the layers of the sun in the correct order from innermost to outermost?
    8·1 answer
  • Which two organisms have a placenta?
    10·2 answers
  • NO LINKS AN A ANSWER
    14·1 answer
  • Explain why eggs and sperm only have half the amount of DNA as a normal body cell.
    10·1 answer
  • What is the difference between a mass extinction and a regular (background) extinction? (1 point)
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!