1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Karolina [17]
2 years ago
14

Which is the most abundant chemical found in living cells?

Biology
1 answer:
babunello [35]2 years ago
6 0

Answer:

Water

Explanation:

You might be interested in
If an individual with diabetes plans to take this supplement, what would be the recommendation?
Marina CMI [18]
I think the best recommendation would be to count carbohydrate content of the supplement as part of total daily intake. A diabetic diet should be a healthy diet rich i nutrients, lean proteins, low in fats and calories. key elements are fruits, vegetables and whole grains. Healthy eating is key as it helps keep the blood sugar in the target range. In addition, using healthy diet blood sugar using healthy diet can prevent complications of diabetes.
5 0
3 years ago
How do biotic and abiotic factors affect the characteristics of an ecosystem
valina [46]

Explanation:

Biotic factors such as the presence of autotrophs or self-nourishing organisms such as plants, and the diversity of consumers also affect an entire ecosystem. Abiotic factors affect the ability of organisms to survive and reproduce. Abiotic limiting factors restrict the growth of populations.

3 0
3 years ago
How many water conflicts has there been in North America since 1748?<br>​
Oliga [24]

Answer:

Para ello, asegura que debe utilizar la almacenada en la presa la Boquilla, en el estado de Chihuahua, en el norte del país.

Explanation:

denadaa

7 0
2 years ago
Question 5
ArbitrLikvidat [17]

The environmental effects of an individual or group in terms of resources used and waste produced is an individual or group's ecological footprint (option A).

<h3>What is ecological footprint?</h3>

Ecological footprint is the measure of how much biologically productive land and water area an individual, population or activity requires to produce all the resources it consumes and to absorb the waste it generates using prevailing technology and resource management practices.

Living organisms make use of resources in the environment and these can either leave negative or positive effect on the environment that will affect sustainability.

Therefore, it can be said that the environmental effects of an individual or group in terms of resources used and waste produced is an individual or group's ecological footprint.

Learn more about ecological footprint at:brainly.com/question/14441911

#SPJ1

8 0
2 years ago
THE MENSTERUAL CYCLE <br><br> Fill in the missing blanks
IrinaVladis [17]
1) 28 2) ovaries 3) fallopian tube 4) ovaries 5 & 6) ovary 7) ovulation 8 & 9) uterus 10) fallopian tube 11) sperm cell 12) uterus 13) fertilized 14) blood 15) uterine 16) vagina 17) 28 18) menstruation
3 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Humans have 23 chromosome pairs. other members of the hominidae, including chimpanzees, gorillas, and orangutans, have 24. what
    13·1 answer
  • Water is warmed by the sun and evaporates because
    7·2 answers
  • This is the role of a species in an ecosystem, consisting of such things as what it eats, when it eats, and where it lives.
    6·1 answer
  • Which of the following identifies a successful adaptation in hominids over time?
    11·1 answer
  • Which is a characteristic of something in the domain archaea?
    12·2 answers
  • Vascular plant is to nonvascular plant as cactus is to -
    11·1 answer
  • PLEASE HELP SCIENCE PLEASE
    10·2 answers
  • If a leaf appears toothed,what type of leaf edge is it
    12·1 answer
  • Because of the Doppler effect, sounds coming from a moving source
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!