Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer: Fungi are microscopic heterotrophic living organisms that grow as long threads called hyphae. In terms of their function, they can be divided into-
Parasitic fungus that obtains nutrients from living host while harming it, mutualistic fungus that obtains nutrients and inturn provides benefit provides to the host, and saprophytic fungus that are mainly classified as decomposers.
Thus, correct match is as-
A) Parasitic fungus- 4) lives within the blood of another organism and causes disease
B) Mutualistic fungus - 5) lives around the roots of a tree and provides nutrients to the tree
C) Saprophytic fungus- 2) lives in a marsh environment and aids in biodegradation.
The answer is fixed interval
I hope that helped
Answer:
They allowed businesses to operate with few regulations.
The Vitamin C will probably get decreased due to the food it is processed by.