Answer:
When 2 slabs of continental lithosphere collide, it creates mountains.
Explanation:
a complete map of all potential genes a map disease-linked genes a genetic map of the 23 human chromosomes a list of all the genetic base pairs
When Amanda poured some of the liquid in a test tube, she noticed that the edges of the water curved upward, which is an example of adhesion.
When Pol filled another test tube to the top, the liquid formed a low dome, which is evidence of cohesion.
When Amanda added table salt to the first test tube and shook it, she noted that the liquid had dissolved the solute.
All of these observations indicated the presence of covalent bonds.
Pol determined that the pH of the sample is 7, which shows the sample is neutral.
Based on all of the evidence Amanda and Pol gathered, the unknown liquid is water.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
The trait that first appears or is visibly expressed in the organism is called the dominant trait. The trait that is present at the gene level but is masked and does not show itself in the organism is called the recessive trait.
Explanation:
