1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kaylis [27]
3 years ago
9

Where can you find electrons in an atom? PLEASE

Biology
2 answers:
Keith_Richards [23]3 years ago
6 0

Answer:

Nucleus

Explanation:

artcher [175]3 years ago
3 0

Answer:

OUTSIDE the nuclues

Explanation:

Only nuetrons and protons are inside the nucleus, electrons are outside the nucleus.

Hope this helps! If it did, please give me brainliest! It would help a lot! Thanks! :D

You might be interested in
I need help...thank you in advance!
Nataliya [291]
This should have been more points but I’m not really good with bones
7 0
3 years ago
Read 2 more answers
The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.
Llana [10]

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

3 0
3 years ago
Read 2 more answers
At the completion of mitosis, the nucleus of a human somatic cell has ___ chromosomes.
Natasha_Volkova [10]
46 chromosomes. Each consisting of one chromatid
4 0
3 years ago
Domain is a newer portion of the classification system that includes Eukarya and Prokarya. What information most likely dictated
olga2289 [7]

New data about evolutionary relationship between organisms

Explanation:

New data about the evolutionary relationship between organisms most likely dictated that the domain level is adopted.

  • Evolutionary trends and morphological relationship between organisms became very important in the classification system.

Organisms are classified into the domain levels as:

  1. Archaea,
  2. Bacteria,
  3. Eukarya

This classification is based on the sequences of nucleotides in the cell.

Learn more:

Domain brainly.com/question/7172507

#learnwithBrainly

8 0
2 years ago
Read 2 more answers
How does commensalism differ from mutualism?
Veseljchak [2.6K]
Answer: Mutualism is a relationship of two organisms wherein both organisms benefit from each other. ... Commensalism is a relationship of two organisms wherein one organism benefit from the other with neither harm nor benefit to the other
5 0
3 years ago
Other questions:
  • Describe the moisture content of a body of air as prevailing winds carry it across the ocean toward land
    10·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Describe how waves superpose on each other using specific examples from two types of waves
    6·1 answer
  • What is the pupil of the eye? select one:
    9·1 answer
  • Compared to the weight of a person at the North Pole, the weight of the same person at the Equator would be
    14·1 answer
  • What are some health and hygiene practices you should use in or
    10·1 answer
  • Which multicellular invertebrate uses tentacles with stinging cells to capture prey?
    14·1 answer
  • Which definition is the best for “semipermeable membrane”?
    5·1 answer
  • What is the scientific name for a bacterial cell?
    5·1 answer
  • What type of signal is long-lasting and works at night? A) olfactory
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!