1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondor19780726 [428]
3 years ago
6

Who wants to meet my brother, Ashton? D.A.R.E. Q.U.E.S.T.I.O.N.

Biology
2 answers:
ryzh [129]3 years ago
7 0

Answer:

meh

Explanation:

lol

egoroff_w [7]3 years ago
5 0

Uh. Sure? ig

uh

yah

eheh

ok.

You might be interested in
Which of the following would NOT conserve energy from fossil fuels? *
Ulleksa [173]

Answer:

C using gas for heat

Explanation:

only thing that uses fossil fuels

6 0
2 years ago
What did Darwin conclude after finding clam fossils in the mountains?
KIM [24]
Darwin concluded that the sea level was high were it reached the mountain and as times passed sea level lowers down and clams were still on the mountain so when they died they were fossilized in the mountains. Hope this helps
5 0
4 years ago
Which criteria allow biologists to divide chemicals into macronutrients and micronutrients?
lara31 [8.8K]

Answer:

The requirement of different nutrients, divide them into 2 categories.

Explanation:

On the basis of requirement of nutrients in our food, the chemicals are divided into 2 types - macronutrients, and macronutrients.

Nutrients are the molecules present in the food nourishes the living organisms. The macronutrients are needed in large quantities and they provide energy to the organism.

There are 3 major macronutrients present in every kind of food - proteins, fats, and carbohydrates.  

On the other hand, micronutrients are required very less amount to the animals. But they are important for nourishment of the body, but their quantity is very less. Example of micronutrients are vitamins, minerals, manganese, iron, potassium, etc.

Therefore, it is told one should take balance diet to get all the nutrients.

7 0
4 years ago
Which step of mitosis involves the spindle fibers pulling the chromosomes to opposite ends of the cell?
sveta [45]
The answer they want is "Telophase" without quotes
7 0
4 years ago
Read 2 more answers
Anyone got any good chewy chocolate chip cookie recipes
nordsb [41]
No, but you can always turn to google, or ask a relative as they may be more experienced.
7 0
3 years ago
Other questions:
  • Two quick multiple choice biology questions! (For a couple extra points) ANSWER BOTH SERIOUSLY OR YOUR ANSWER WILL BE REMOVED
    12·1 answer
  • Which of the following best describes an adaptation that developed, enabling primitive plants to make the transition to survival
    9·1 answer
  • Jamie is reviewing a new diet plan that involves purchasing pre-packaged meals and taking a patented energy supplement. In an ad
    12·2 answers
  • Which of the following best describes the process of meiosis? (2 points)
    6·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • How does erosion cause rounding?
    11·1 answer
  • A sorting device made up of a system of choices that is used to classify organisms is called _____. a key systematics taxon a ch
    12·2 answers
  • What is the goal of meiosis? How many daughter cells do you have at the end of meiosis?
    5·1 answer
  • In peas, yellow seed color (V) is dominant to green seed color (y). Which describes an organism that has nonidentical
    10·1 answer
  • 32. Sucrose is made of one glucose molecule and one fructose molecule. This means sucrose is a:
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!