1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gre4nikov [31]
3 years ago
10

Is Mayonaise an Instrument?

Biology
1 answer:
Yuliya22 [10]3 years ago
3 0
Oh 100%
If Patrick believes it is then it is
You might be interested in
Why is osmosis important to the survival of a cell
stiv31 [10]

The most important function of osmosis is stabilising the internal environment of an organism by keeping the water and intercellular fluids levels balanced. In all living organisms, nutrients and minerals make their way to the cells because of osmosis. This obviously is essential to the survival of a cell.

3 0
3 years ago
Read 2 more answers
Sound waves travel much then electromagnetic waves do
Musya8 [376]

Answer:

That’s an interesting question

Explanation:

Huh let’s think???

3 0
3 years ago
An apple and a glass of milk can give you more nutrition as compared to the milk shake
Dmitriy789 [7]

Answer:

True

Explanation:

because the milk shake is with cold but milk is hot

8 0
3 years ago
A scientist investigates two types of cells located in different parts in a human body. Cell A contains many more mitochondria t
Ket [755]

Answer: Cell A does more work than cell B.

Mitochondria is the energy producer organelle of the cell. It produces energy in the form of ATP molecules. It is a membrane bound organelle which is only present in eukaryotic cells not found in prokaryotic cells. Presence of more number of mitochondria in the cell indicates that the energy requirement of the cell is more. This energy is required for cellular metabolism. Therefore, cell with more mitochondria works more than the one with less mitochondria.

5 0
3 years ago
Read 2 more answers
What is the difference between potential energy and kinetic
Anon25 [30]

Answer:

Potential energy is the energy of an object due to its position, while  kinetic energy is energy due to its motion.

Explanation:

3 0
3 years ago
Other questions:
  • The following table shows the kinds of seed that are commonly eaten by four types of birds. In the table, an X indicates that th
    13·1 answer
  • Biological classification how are organisms grouped sorted and classified answers key
    6·1 answer
  • Do prokaryotes cells have a nuclear membrane
    7·1 answer
  • A science student makes the following statement. A raccoon may live longer when it eats only vegetables. What is the student doi
    7·1 answer
  • When during fetal development do rhythmic breathing movements begin?
    8·2 answers
  • A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
    5·1 answer
  • What are three inorganic components of soil
    11·1 answer
  • How are water molecules arranged in a liquid?
    9·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Why does the lake need to be older than the canyon for the spillover theory to work?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!