1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rudik [331]
3 years ago
14

The type of inheritance show when a red-lowering plant is crossed with a white-flowering plant and only pink flowering plants ar

e produced is
Biology
2 answers:
gladu [14]3 years ago
7 0

Answer:

Incomplete Dominance :3

mario62 [17]3 years ago
5 0

Answer:

Co-dominance Is the right answer.

It is when allele A and allele B are both expressed. Which leads to the fuse of red and white :)

You might be interested in
PLEASE PLEASE HELP I WILL GIVE BRAINALIST
Ne4ueva [31]

Answer:

what do u need help with?

Explanation:

6 0
3 years ago
Read 2 more answers
How do introduced species become established in a new ecosystem? Check all that apply.
Fed [463]
The answer is 1,3,4,6,8.
7 0
3 years ago
Read 2 more answers
What is the main difference between muscle cells and nerve cells?
RideAnS [48]

Answer:

They have different ribosomes.

Explanation:

8 0
3 years ago
Read 2 more answers
a plants water supply is now deeper in the ground. by which process do the roots grow longer to reach the water? a. photosynthes
pantera1 [17]
Mitosis, since it involves the process of splitting into two daughter cells.
5 0
3 years ago
Read 2 more answers
From his observations of organisms in the Galapagos Islands, Darwin reasoned that __________. a. the shape of a bird's beak does
steposvetlana [31]

Answer:

C.organisms had adapted to new environments,givingrise to new species

Explanation:

-On his visit to the Galapagos Islands, Charles Darwin discovered several species of finches that varied from island to island, which helped him to develop his theory of natural selection.

-He noticed that each finch species had a different type of beak, depending on the food available on its island. The finches that ate large nuts had strong beaks for breaking the nuts open.

8 0
3 years ago
Other questions:
  • Please help really need this:
    5·1 answer
  • How much weight can you lose fasting for 24 hours?
    15·1 answer
  • How does temperature affect the amount of carbon dioxide that yeast cells produce
    8·1 answer
  • Olfactory information is sent to all of the following areas except the __________.
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Brachiation is a form of locomotion: a. where movement occurs through the use of the arms and a specially adapted tail, which ca
    13·1 answer
  • Which of the following is a human and economic demand that is straining forests throughout the world?
    7·1 answer
  • Which molecules in your body do not contain carbon atoms
    5·1 answer
  • Help me out please<br> ill mark you as brainliest
    15·1 answer
  • Populations at genetic equilibrium
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!