1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cluponka [151]
3 years ago
7

The digestive and excretory systems project explaining macromolecules in the body

Biology
1 answer:
levacccp [35]3 years ago
7 0

Answer:

Our digestive system has the ability to convert macromolecules into micromolecules.

Explanation:

Our digestive system has the ability to convert macromolecules into micromolecules with the help of certain enzymes. Carbohydrate is a macromolecule which is converted into glucose molecule with the help of saliva which is an enzyme present in the mouth, protein is also a macromolecule that is converted into amino acid so that our body cells can absorb it and fats are also macromolecules which can be converted into fatty acids with the help of digestive system. The cells produced waste materials such as carbondioxide gas and nitrogenous material which can be excreted through excretory system such as lungs and urinary bladder.

You might be interested in
A fault or intrusion is younger than the rock it cuts through according to the..
Vikentia [17]
Law of crossing cutting relationships is the right answer
7 0
3 years ago
in the image below, what molecule is being released by cellular respiration and used in photosynthesis ​
olasank [31]

Answer:

the answer is B

Explanation:

plants need carbon dioxide to be able to produce anything

4 0
4 years ago
What happens during each part of the interphase?
Alex777 [14]

Answer:

Interphase is the longest stage in the eukaryote cell cycle. During interphase, the cell acquires nutrients, creates and uses proteins and other molecules, and starts the process of cell division by replicating the DNA. Interphase is divided into three distinct stages, Gap 1, Synthesis, and Gap 2, which are discussed below.

Explanation:

Hope this helps!!

-BB

4 0
3 years ago
An individual muscle such as the biceps brachii belongs to the ______ organ systems.
omeli [17]

Answer:

Skeletal Organ System.

6 0
3 years ago
An evolutionary psychologist would suggest that people are genetically predisposed to.
Butoxors [25]

An evolutionary psychologist would suggest that people are genetically predisposed to fear dangerous animals, love their own children, and seek healthy-looking mates.

<h3>Who is an Evolutionary psychology?</h3>

This refers to a branch of science which studies how the brain has evolved from generation to generation and also involves human behavior being viewed through the lens of evolution. A professional who specializes in this branch of science is referred to as an evolutionary psychologist.

As humans, we strive daily for our optimal survival over the years which is why it is imperative and a norm to avoid dangerous situations such as encounters with wild animals etc.

It is also a norm to  love our offspring and finding a healthy mate for better companionship which is common with almost all animals which is therefore the reason why evolutionary psychologist would suggest that people are genetically predisposed to these conditions.

Read more about Evolutionary psychologist here brainly.com/question/10946160

#SPJ1

8 0
2 years ago
Other questions:
  • How many species of baobab trees found in Africa
    15·1 answer
  • The name of the ovulated structure prior to fertilization
    9·1 answer
  • Compared to the Linnaean system of classification, what is the advantage of classifying species into clades? A. Clades show evol
    9·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • The genetic code is:
    15·1 answer
  • PLEASE HELP !!<br> ILL GIVE BRAINLIEST <br><br> NO LINKS OR FILES.
    5·2 answers
  • PLSS HELP!!<br> explain in detail different types of receptors
    9·1 answer
  • *PLEASE ANSWER ILL PICK BRAINLIEST*
    11·1 answer
  • How does a bacteriophage work.
    13·1 answer
  • Which of these are recommended for preventing some std/sti’s
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!