1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
11

Why do people sometimes do things that they really don’t want to do? Check all that apply.

Law
2 answers:
liubo4ka [24]3 years ago
4 0

Answer:

1/2/4

Explanation:

lina2011 [118]3 years ago
3 0
1. Don’t know how to get out of situation
2. Don’t want to hurt someone’s feelings
3. Want to be liked
You might be interested in
When you want to things but can only afford one of the two the most valued alternative or the one you didn't choose is the a det
Schach [20]

Answer:

D opportunity cost

Explanation:

There is a loss of other alternatives when one alternative is chosen.

4 0
4 years ago
What are the pros and cons of the department of justice information and databases?
coldgirl [10]

Answer:

Criminal justice data is making a difference in a number of areas. These include: ... When these data points are geotagged, law enforcement can narrow the data further and use it to predict when and where certain types of crime are most likely to occur. In real-world usage, such data analytics have proven quite effective.

Explanation:

7 0
4 years ago
Conflicts happen in all careers. What can help to reduce the damage that a conflict can cause on a project or I a team?
irina [24]
All of the above

Hope this helps
5 0
3 years ago
Why is a social contract important to the enlightenment view of the government
Pepsi [2]

Answer:

The Social Contract outlines the basis for a legitimate political order within a framework of classical republicanism. Published in 1762, it became one of the most influential works of political philosophy in the western tradition.

3 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • Who of the following would necessarily be included in the Bureau of Labor Statistics’ “unemployed” category? A. Huey, who did no
    7·1 answer
  • What is likely to result from the event referred to in the headline? A. The representative will realize that campaign finance re
    12·2 answers
  • A victim of a robbery is describing the suspect to you. The victim tells you the robber was holding a “38 special” handgun. Expl
    5·1 answer
  • Is justice served by simply administering punishment?
    12·1 answer
  • if objects B and D were released simultaneously from the same height which one would hit the ground first?
    7·1 answer
  • Okay so this isn’t for homework, I was just curious.
    15·2 answers
  • What does it mean to say that people's choices have future consequences?​
    6·2 answers
  • If you think anything from your vehicle Check just could affect your safety or ability to control your car , you should
    15·1 answer
  • NEED HELP ASAPPP !! Why do you think congress and the White House are unable to agree on a relief bill?
    14·1 answer
  • Which phrase BEST describes a macro-level event?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!