1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natka813 [3]
2 years ago
6

What is the percent increase from 49.5 to 99

Mathematics
1 answer:
ANEK [815]2 years ago
8 0

Answer:

Step-by-step explanation:

100%

You might be interested in
Can someone help me pls 25 points
Ivahew [28]

Answer:

8x^{3}

Step-by-step explanation:

By the laws of exponents we have to multiply each term in the parenthesis by the exponent on the outside:

(2x)^{3}  would be equal to = 8x^{3}

Another way we could write would be (2x)(2x)(2x) = 8x^{3}

The second one is the same, just fill in as 8 and 3

3 0
2 years ago
Read 2 more answers
Anyone plz help me, plz show the working. THANK YOU SO MUCH!
castortr0y [4]
9x+10= 21

Please give me thanks and brainliest, this took lots of hard work and dedication
8 0
2 years ago
PLEASE ANSWER IM IN A TEST
Nitella [24]

Answer:

= C: 282 square feet

Step-by-step explanation:

find the area as a whole.

=300

find the area of the missing sides and subtract the from the whole.

=282

answer= C:282 square feet

6 0
3 years ago
Find the solution to the equation below.<br> 2x^2+3x-20=0
mariarad [96]

Answer:

  x = -4, 5/2

Step-by-step explanation:

A quadratic can be solved may ways, including graphing, factoring, and the quadratic formula. You can also check possible answers by making use of the relationships between solutions and the coefficients.

__

A graph is attached. It shows the solutions to be -4 and 5/2.

__

When factored, the equation becomes ...

  (2x -5)(x +4) = 0 . . . . . has solutions x=-4, x=5/2 (these make the factors zero)

__

Using the quadratic formula, the solutions of ax^2 +bx +c = 0 are found from ...

  x = (-b±√(b²-4ac))/(2a)

  x = (-3±√(3²-4(2)(-20))/(2(2)) = (-3±√169)/4 = {-16, +10}/4

  x = {-4, 5/2}

__

For ax^2 +bx +c = 0, the solutions must satisfy ...

  product of solutions is c/a = -20/2 = -10

Only the first and last choices have this product.

  sum of solutions is -b/a = -3/2

Only the first choice (-4, 5/2) has this sum.

8 0
3 years ago
If (tan^3 theta -1) / (tan theta - 1) - sec^2 theta +1 = 0, find cot theta.
stiv31 [10]
Hey there !

Check the attachment.
Hope it helps you :)

7 0
2 years ago
Read 2 more answers
Other questions:
  • What are the common factors of 9 and 25
    15·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • A cylindrical soup can has a radius of 1.5 in. and is 4.7 in. tall. Find the volume of the can.
    9·1 answer
  • 6th grade math help me pleaseee
    6·2 answers
  • In ΔDEF, the measure of ∠F=90°, the measure of ∠D=62°, and FD = 3.5 feet. Find the length of DE to the nearest tenth of a foot.
    15·2 answers
  • What is the first step in solving this problem? <br> ⅘ + ½ =
    8·2 answers
  • 4/5n = . n = ___? Select one: a.2/15 b.5/6 c. 1 1/5 d. 1 7/15 no links thank you
    14·1 answer
  • BRAINLIEST if correct<br><br> 2.0
    15·2 answers
  • Please help me asap<br><br> ty..
    11·2 answers
  • If STUV is a rectangle, find the measure of angle SUT
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!