1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alina [70]
3 years ago
11

Which gas is exhaled along with used air?SCIENCE QUESTION... ☺️​

Biology
1 answer:
WINSTONCH [101]3 years ago
6 0

Explanation:

When we take a breath, we pull air into our lungs that contains mostly nitrogen and oxygen. When we exhale, we breathe out mostly carbon dioxide.

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
The growth of the plants that reindeer used as food could not keep up with the needs of the reindeer population. what was the pr
Llana [10]

Answer:

a.  the reindeer population exceeded it carrying capacity

Explanation:

not enough food for the reindeers  due to an increase in deer population.

8 0
3 years ago
Read 2 more answers
Heat Transfer discussion based question
lilavasa [31]

Answer: Thermal energy flows from a warmer material to a cooler material.  When thermal energy is transferred to a material, the motion of its particles speeds up and its temperature increases. There are three ways heat is transferred into and through the atmosphere: Radiation, conduction and convection.

Radiation is when energy, in the form of electromagnetic radiation, is emitted by a heated surface in all directions and travels directly to its point of absorption at the speed of light; thermal radiation does not require an intervening medium to carry it. Conduction is the process by which heat energy is transmitted through collisions between neighboring atoms or molecules. Convection is heat transfer by mass motion of a fluid such as air or water when the heated fluid is caused to move away from the source of heat, carrying energy with it.

3 0
3 years ago
The roots of many clover plants produce structures that are filled with bacteria. The clover plants provide food and shelter for
ivanzaharov [21]

The type of relationship that occurs between the clover plants and the bacterias is called mutualism.

<h3>What is Mutualism?</h3>

Mutualism is an ecological relationship between individuals of different species, in which both are benefited by the interaction. As it occurs between individuals of different species, it is a so-called interspecific relationship, and, as it benefits all those involved, it is called a harmonic relationship.

See more about ecology at: brainly.com/question/25953800

#SPJ1

7 0
1 year ago
Which composition of water moves within a deepwater current?
mariarad [96]

Answer:

cold and high salinity

3 0
3 years ago
Read 2 more answers
Other questions:
  • Before starch can enter a cell it must be digested to form simple sugars. Why?
    9·1 answer
  • A biologically based addiction is a condition in which
    13·1 answer
  • Which part of the phospholipid bilayer interacts with water, and which part does not interact with water?
    11·2 answers
  • What is the key term for the mass of bacteria that forms when bacteria are grown on agar?
    15·1 answer
  • The portion of the membrane system In eukaryotic cells that is responsible for making liquids and breaking substance is the
    7·1 answer
  • When prokaryotic bacterial cells undergo cell division, the single circular chromosome replicates to form a second chromosome. T
    13·1 answer
  • What can a deficiency of growth hormone during bone formation cause? what can a deficiency of growth hormone during bone formati
    6·1 answer
  • Which best explains how coal deposits formed?
    6·1 answer
  • How does abnormal development take place in man?
    7·2 answers
  • A volcanic eruption changes the environment and separates a population of foxes. These two new populations are no longer able to
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!