I don’t understand what u say
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Respiration using oxygen to break down food molecules is called aerobic respiration. 'Aero' means air, which contains oxygen, leading to the name aerobic respiration. Glucose is the molecule normally used for respiration - it is the main respiratory substrate. Glucose is oxidised to release its energy, which is then stored in ATP molecules.
The word equation for aerobic respiration is:
glucose + oxygen → carbon dioxide + water (+ ATP made)
You need to be able to recognise the chemical formulas:
C6H12O6 + 6O2 → 6CO2 + 6H2O
The correct answer is C. Estivation
Explanation:
In biology, estivation refers to a lethargic state that is mainly prompted by high temperatures, different from hibernation that occurs in the winter or at low temperatures. However, as hibernation estivation implies the organism of animals lowers the metabolic rate with the purpose of avoiding to die due to the high temperatures and the lack of resources including water. This can occur in both vertebrate and intervertebral animals including small animals. This implies, the mouse described which is a small animal probably is going through estivation as due to hot temperatures the organism lowers the metabolic rate, which is exactly what occurs in this process.
