1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RoseWind [281]
3 years ago
14

AACGTACGATCGATGCACATGCATGGCTACGC

Chemistry
2 answers:
Pachacha [2.7K]3 years ago
7 0

Explanation:

if u have biology A=T and G=C

id.k what ur question is supposed to mean..

den301095 [7]3 years ago
6 0

Answer:

A^8, C^7, G^8, T^5

Explanation:

:D

You might be interested in
Increasing the temperature of a chemical equilibrium system that naturally releases heat in the forward direction will _________
Lisa [10]
<span>I think D. shift the equilibrium reaction to favor the endothermic process. </span>
4 0
3 years ago
Read 2 more answers
A chemistry student needs 65.0 mL of carbon tetrachloride for an experiment. By consulting the CRC Handbook of Chemistry and Phy
Anna007 [38]

Answer:

103.3 g

Explanation:

Data Given:

Volume of carbon tetrachloride (v) = 65.0 mL

Density of carbon tetrachloride (d) = 1.59 g/cm³

Solution:

Convert volume of carbon tetrachloride from ml to cm³

1 ml = 1 cm³

so,

65.0 mL = 65.0 cm³

Formula used to calculated mass of carbon tetrachloride should be taken for experiment.

                   d = m/v

Rearrange the above equation:

                   m = d x v . . . . . . .(1)

Put values in equation 1

                   m = 1.59 g/cm³ x 65.0 cm³

                   m = 103.3 g

6 0
4 years ago
HELP!! Suppose that the pressure of 1.00 L of gas is 380 mm Hg when the temperature is 200. K. At what
Korolek [52]
Numa máquina térmica uma parte da energia térmica fornecida ao sistema(Q1) é transformada em trabalho mecânico (τ) e o restante (Q2) é dissipado, perdido para o ambiente.



sendo:

τ: trabalho realizado (J) [Joule]
Q1: energia fornecida (J)
Q2: energia dissipada (J)


temos: τ = Q1 - Q2

O rendimento (η) é a razão do trabalho realizado pela energia fornecida:

η= τ/Q1

Exercícior resolvido:
Uma máquina térmica cíclica recebe 5000 J de calor de uma fonte quente e realiza trabalho de 3500 J. Calcule o rendimento dessa máquina térmica.

solução:

τ=3500 J
Q1=5000J

η= τ/Q1
η= 3500/5000
η= 0,7 ou seja 70%

Energia dissipada será:



τ = Q1 - Q2
Q2 = Q1- τ

Q2=5000-3500
Q2= 1500 J

Exercicio: Qual seria o rendimento se a máquina do exercicio anterior realizasse 4000J de trabalho com a mesma quantidade de calor fornecida ? Quanta energia seria dissipada agora?



obs: Entregar foto da resolução ou o cálculo passo a passo na mensagem
4 0
3 years ago
Which two factors must be considered when predicting whether two substances will dissolve in each other?
r-ruslan [8.4K]

The two factors must be considered when predicting whether two substances will dissolve in each other are type of bonds and size of the molecules are two factors.

<h3>What is solubility?</h3>

Solubility is the ability of solute particles to dissolve in any solvent, and solubility is directly proportional to the dissolving ability of the solute.

Solubility of any substance depends on the type of the bond present in the solute molecule i.e. polar or non polar. And it is also depends on the size of the solute as size defines the surface tenssion of the substance.

  • Number of bonds and shape of molecules are also define the solubility but not at that extent as their type and shape.

Hence type of bonds and size of the molecules are two factors.

To know more about dissolution, visit the below link:
brainly.com/question/26073928

6 0
2 years ago
Vitamins are food.<br> True OR False
Serga [27]

Answer:   Hello!

False

Explanation:

hope you do good!they are in ur food though

6 0
3 years ago
Read 2 more answers
Other questions:
  • Where would you expect to find sedimentary rocks?
    8·1 answer
  • The composition of dry air at sea level is 78.03% N2, 20.99% O2, and 0.033% CO2 by volume. (a) calculate the average molar mass
    12·1 answer
  • How many atoms are there in 2.43 g of mercury?
    5·1 answer
  • What geological principle states that rocks at the bottom of a sequence
    11·1 answer
  • Describe the relationship between Sun Angle and Sun Length. Explain this change occurs.. ?
    14·1 answer
  • What is the relationship between the atomic numbers and ionic radii of the elements in the group 7a
    5·1 answer
  • Which kind of bond occurs when two atoms share an electron
    11·1 answer
  • The process of fermentation involves chemical reactions that convert solid glucose (C6H12O6) into aqueous ethanol and carbon dio
    11·1 answer
  • 5) answer is A
    10·1 answer
  • Gizmo Student Exploration: Periodic Trends awner key, Please I need help with this as soon as possible! I have attached what I h
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!