1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Taya2010 [7]
3 years ago
6

Question 19

Mathematics
1 answer:
Otrada [13]3 years ago
4 0

Answer:

The slope is -1/3

You might be interested in
you have a piece of yarn that is 12 1/2 ft long. You need to cut it into strips that are 1 1/4 ft long. how many strips will you
zysi [14]

Answer:

A.

Step-by-step explanation:

12.5/10=1.25.

12.5/8=1.56

12.5/12=1.04

12.5/6=2.08

it's important to know what 1/2 is, 1/3 is, 1/4 is and 1/5 it's also important to know things like 2/2, 2/3, 3/3, 2/4, 3/4, 4/4, 2/5, 3/5, 4/5, and 5/5. You don't need this until 8th grade though. But get on it if you can. Ask your parents or teacher.

5 0
3 years ago
Isabella earns $48.75 for 5 hours of babysitting. At this rate, how much more would she earn for 11 hours of babysitting?
MAVERICK [17]
She would earn $107.25
4 0
3 years ago
Read 2 more answers
Simplify the equations:8(y-x)-2(x-y)<br> HELP ASAP!!
SVEN [57.7K]

Answer:

simplified equation is 10y-10x

Step-by-step explanation:

8(y-x) -2(x-y)

multiple 8 and 2 by the corresponding parentheses

8y-8x -2x +2y

10y -10x

5 0
3 years ago
What perfect square that is between 1 and 100 has 27 as one of its factors?
astra-53 [7]

Answer:

81

Step-by-step explanation:

Its a perfect square and 27*3=81

6 0
3 years ago
Let g(x) = 3x + 2. If g(x) = 11, what is x?
astraxan [27]

Answer:

3=x

Step-by-step explanation:

11=3x+2

5 0
3 years ago
Other questions:
  • Twice the difference of a number and seven is equal to three times the sum of the number and seven
    13·1 answer
  • A basket contains 4 green marbles and 8 blue marbles. a marble is drawn without replacement. then another marble is drawn. what
    9·1 answer
  • What is the approximate area of a circle with a diameter of 28 yards?
    13·1 answer
  • What is the value of x?<br><br>Enter your answer in the box.<br><br>x=​
    7·1 answer
  • Need help simplifying
    7·1 answer
  • Rylee earns $5,4000 in her first year of teaching and earns a 3% increase in each successive year. Write a geometric series form
    14·1 answer
  • What is the distance between <br> (2,3) (8,9)
    11·1 answer
  • Mr Smith class 1/3 were absent on Monday and Mrs. Brown class 2/5 were absent on Monday. If 4 students from each class were abse
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is the solution of this quadratic equation? x2 + 10 = 0
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!