1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex777 [14]
2 years ago
6

Need help, i will give free cookies <3 - dont guess please-

Biology
1 answer:
kotegsom [21]2 years ago
8 0
I’m pretty sure it’s c but I might be wrong
You might be interested in
Match the correct function to the structure of the skin (muscles, oil glands, nerve endings)
Andru [333]

Was this question supposed to have a second part?

Explanation: Brainly do not fuss at me for using the answer thing to ask this! The option to comment is not available for some reason, and if the answer to my question is yes no one could answer it yet anyway

6 0
3 years ago
Read 2 more answers
Please help with this tell me what to put for each number pls &lt;3
dybincka [34]

Answer:

1: Organism

2: Population

3: Community

4: Ecosystem

(the word bank literally gave it away)

Explanation:

You can see that box 1 is next to 1 animal, so it's an organism.

You can see box 2 is next to a group of the same animals, so it's a population

You can see box 3 is next to a small group of multiple species, so it's a comunity

You can see box 4 is next to a fully functioning group of species, so it's called an ecosystem

8 0
3 years ago
Why Is It Important To Avoid Applying Too Much Nitrogen Fertilizer?
Korolek [52]

Answer:

Under the soil, root growth often suffers. Nitrogen fertilizers can increase the salt content of soil, which can cause plants to get dehydrated. ... You will be more likely to notice damage from excess nitrogen to your plants, if the weather is drier than normal.

Hope This Help...

Explanation:

5 0
3 years ago
Read 2 more answers
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
The correct sequence for the five phases in the systems development life cycle (sdlc) process is?
Sophie [7]

The correct sequence for the five phases in the systems development life cycle (SDLC) process is system analysis, conceptual design, physical design, implementation and conversion, and operations and maintenance

The study of life cycles is crucial to fostering children's global awareness and assisting them in grappling with difficult ideas like life, death, and birth. A life cycle approach can aid in our decision-making. It means that everyone has a responsibility and a part to play throughout the entire chain of a product's life cycle, from creation to disposal, taking into account all pertinent repercussions on the economy, the environment, and society.

A life cycle is a progression of stages that a living creature experiences. Life cycles are common to both plants and mammals. Diagrams are useful for illustrating the stages, which sometimes involve beginning as a seed, egg, or live birth, then growing up.

To learn more about the Life cycle please visit -
brainly.com/question/12600270
#SPJ4

4 0
1 year ago
Other questions:
  • Which of the following statements about lipid processing is/are correct? Choose all that apply.
    5·1 answer
  • A forest contains red oak sugar maple and white spruce trees. Is this forest considered a population
    6·2 answers
  • What microscope has magnification ability of up to 60,000 times without losing clarity
    6·1 answer
  • Where in an embryo are the instructions located for how to build organs?
    12·2 answers
  • 2) The production of pink flowered plants from a cross between a red flowered plant and a white flowered plant is an example of
    11·2 answers
  • What would cause the gravitational force to be different in different locations?
    7·2 answers
  • An organism that lives in environmental conditions so extreme that few other species can survive there are ________.
    8·1 answer
  • By what process do streams and rivers move material?
    12·1 answer
  • If a DNA code was T-G-G-A-C, what would be the RNA code that matched the DNA?
    9·1 answer
  • What is the purpose of the code in DNA?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!