1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marin [14]
2 years ago
12

Research any harmful bacteria and write a short paragraph about it that includes:

Biology
1 answer:
alukav5142 [94]2 years ago
4 0

Answer:

Noroviruses are a group of viruses that cause gastroenteritis in people. Gastroenteritis is an inflammation of the lining of the stomach and intestines, causing an acute onset of severe vomiting and diarrhea. Norovirus illness is usually brief in people who are otherwise healthy. an RNA virus of the family Caliciviridae, is a human enteric pathogen that causes substantial morbidity across both health care and community settings, causes vomiting and diarrhea. People of all ages can get infected and sick with norovirus. Norovirus spreads easily! You can get norovirus by accidentally getting tiny particles of feces (poop) or vomit from an infected person in your mouth.

Explanation:

It's a bacteria it's says virus but it's a bacteria

You might be interested in
What did Malthus predict about the human population.
Digiron [165]

Answer:

The human population would eventually grow too large to be sufficiently supported by the food available.

Explanation:

He found that food production did not increase at an exponential rate but instead increased more slowly.

3 0
3 years ago
Read 2 more answers
What should James use to convert sunlight into electricity?
amm1812

Answer:

did you ever get the answer to this because i need it

Explanation:

7 0
2 years ago
Read 2 more answers
HELP?! <br> What is the last step in the cell cycle?
nikklg [1K]

Answer:

Death I guess?

Sorry for wasting ur points, u can report this if u want

5 0
2 years ago
Read 2 more answers
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
2 years ago
How can a change in biotic factors change the population of an organism? Use the words limiting factor in your response.
Simora [160]
I like turtles and fat cats
4 0
3 years ago
Other questions:
  • Which of the species you germinated was monocot? Whcih on was a dicot
    11·1 answer
  • Many bacteria, such as
    5·1 answer
  • Which molecules store and transmit genetic information
    15·1 answer
  • Apply what you know about how energy is transferred between trophic levels to explain why there can be only one Great White shar
    11·1 answer
  • What stage of developement are mountain streams in
    8·2 answers
  • Antipsychotic drugs generally refer to drugs used to treat __________.
    12·1 answer
  • Describe ways to produce meat more efficiently, humanely and sustainably. How can we make aquaculture more sustainable. Define o
    12·1 answer
  • What forms when one oceanic plate is forced beneath another plate?
    6·2 answers
  • Pls help me on this I’ve asked 3 times already , biology ppl
    14·1 answer
  • What was Frank’s body temperature before thrax entered?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!