1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natita [175]
3 years ago
7

How many bacteria would there be if 500 bacteria underwent fission every 20 minutes for an hour?

Biology
1 answer:
Alex73 [517]3 years ago
3 0

Answer:

hjftjir?urififukfjf

Explanation:

Genel bilgi toplama sistemi yani GBT, ülkemizde, İçişleri Bakanlığı'na bağlı olarak “Adli Sicil Yönetmeliği” ile uygulanan bir veri toplama uygulamasıdır. ... Sistem, mahkeme kararı ya da hakkında adli karar olmadan değiştirilmesi mümkün olmayan verileri içermektedirGenel bilgi toplama sistemi yani GBT, ülkemizde, İçişleri Bakanlığı'na bağlı olarak “Adli Sicil Yönetmeliği” ile uygulanan bir veri toplama uygulamasıdır. ... Sistem, mahkeme kararı ya da hakkında adli karar olmadan değiştirilmesi mümkün olmayan verileri içermektedirGenel bilgi toplama sistemi yani GBT, ülkemizde, İçişleri Bakanlığı'na bağlı olarak “Adli Sicil Yönetmeliği” ile uygulanan bir veri toplama uygulamasıdır. ... Sistem, mahkeme kararı ya da hakkında adli karar olmadan değiştirilmesi mümkün olmayan verileri içermektedir

You might be interested in
What plausible causal channel(s) runs directly from the treatment to the outcome?
IrinaVladis [17]
A high-interest rate means the opportunity cost to built or buy a house is high it is a possible channel. So when the interest rate is higher, there may be fewer new housing starts. The abstract point-scoring task requires a minimal model that illustrates a plausible causal channel.
3 0
3 years ago
Help Plisss !!!!!!!!!!!
Wittaler [7]

Answer:

c

Explanation:

5 0
3 years ago
Why do frogs retract their eyes
solniwko [45]
So they can breatheso they can breatheso they can breathe<span>so they can breathe

</span>
3 0
3 years ago
An individual who is establishing a strategy to use in order to accomplish a goal is demonstrating which phase of the self-regul
qwelly [4]

Answer:

Forethought

Explanation: Basically means planning ahead of time in order to know what to do when you are faced in a situation or event that will happen in the future

7 0
3 years ago
What are check points and why are they important in the cell cycle
pentagon [3]
Hmm this is a rough explanations but because to be sure cells are made properly and not misfunctioning or going Rouge.

Cancer cells is an example of this, a cell goes rouge and starts doing it's function on it's own but outside of it's brother cells function slightly different turning into a growth or etc. The body thinks it is normal during the check body it's composed of the dna that passes this check.

viruses and other things don't pass this check and things like white blood cella come shut it down.

that's why doctors poison the area they find the cancer. to send white blood cells there to shut the area down not passing the check.
8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Acacia can be found in all of the following forms except
    15·1 answer
  • How is the speed of a rivers flow determined??????
    5·1 answer
  • When a doctor needs to give someone a medication intravenously (through a vein), they dilute that medicine in a saline solution
    8·1 answer
  • BRAINLIESTTT ASAP!! PLEASE HELP ME :)
    6·1 answer
  • All BUT one factor contributes to biological evolution. That is...
    11·2 answers
  • 1. Which of the following refers to the process of an environment constantly changing?"
    6·2 answers
  • Transcribe DNA sequence GGTCAATGCCATAAG into mRNA
    11·1 answer
  • What uses bacteria to copy DNA?
    9·1 answer
  • Children's steady growth, brain maturation, and intellectual advances make middle childhood a time for more _____.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!