4. What is the difference between a Nucleolus and a Nucleoid?
2 answers:
The nucleus is the largest and the most important cell organelle in a eukaryotic cell. A nucleus is a membrane-bound organelle that houses the genetic material of eukaryotes in DNA. The nucleus consists of protein fibres or the DNA inside chromatin fibres. Nucleoids contain the genetic material of prokaryotes in the cytoplasm. The nucleoids usually consist of a single chromosome.
Let us look at more difference between nucleus and nucleoid in the table given below.
You might be interested in
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
