1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eva8 [605]
3 years ago
12

ANSWER QUICKLY PLEASE I DON’T UNDERSTAND. EASY POINTS.

Biology
1 answer:
Arte-miy333 [17]3 years ago
8 0

Enzymes are not reactants and are not used up during the reaction. Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction. This means that for each reaction, there does not need to be a 1:1 ratio between enzyme and substrate molecules.Answer:

Explanation: now gimmie that coochie luigie

You might be interested in
Which of the following does not describe hormones in the body? I’ll mark the correct answer a brainliest
myrzilka [38]

I think its C. hormones act on muscles and glands only. Because hormones act on cells, tissues, organs etc. So this is incorrect and the rest of them are correct.

5 0
3 years ago
Role of Lipids and Carbohydrates - Type Lipid or Carbohydrate behind each question. 16. Provide long term energy storage. 17. Pr
zhuklara [117]

Answer:

16. Carbohydrates  

17. Lipids

18. Carbohydrates

19. Carbohydrates

20. Lipids

21. Lipids

22. Carbohydrates

23. Lipids

Explanation:

Carbohydrates are organic molecules composed of carbon, hydrogen and oxygen. Carbohydrates can be classified into three types: monosaccharides (e.g. glucose), disaccharides (e.g., lactose), and polysaccharides (e.g., starch). Cellulose is a carbohydrate where many glucose rings chain together, while chitin is a polysaccharide consisting of chains of modified glucose molecules.

Lipids represent a diverse group of organic molecules that include, among others, fats, waxes, oils, hormones, etc. Lipids play a role by insulating (and protecting) the body. For example, there is a layer of fats beneath the skin which enables to maintain body temperature relatively constant. In animals, lipids constitute about 50% of the mass of cell membranes. These membrane lipids are mainly phospholipids, glycolipids and cholesterol. There are hormones that derive from lipids such as steroid hormones, which derive from cholesterol. Some examples of steroid hormones are testosterone, estrogen and cortisol.

4 0
3 years ago
What is aphids? explain in easy words ​
Jet001 [13]

They are little soft bodied insect. They suck the plant's nutritious liquid and if they are in large number, they can kill the plants.

4 0
3 years ago
I just want to k ow if the answer is correct
brilliants [131]
I’m pretty sure that’s right
8 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Mexico has more bio diversity than the United States because it is closer to the what
    12·1 answer
  • Native mammals found in Australia are marsupials. There are no naturally occurring placental mammals, which suggests that Austra
    6·2 answers
  • Which of the following would most likely be the major focus of a biologist?
    12·2 answers
  • Order the steps required to analyze gene expression from a particular cell type using a dna microarray.
    7·1 answer
  • Which is an example of a voluntary group
    10·1 answer
  • Which of these is not associated with tadpole stages of toad or frog
    12·1 answer
  • What are the three<br> parts of the hair SHAFT?
    9·2 answers
  • Help please!!! Will be marked brainliest
    6·2 answers
  • Which of the following biomolecules is responsible for genetic information? *
    5·2 answers
  • It is often desirable to express eukaryotic genes in bacteria, which can make a protein of interest quickly and cheaply. What is
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!