1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alecsey [184]
3 years ago
13

For a series of experiments, a linkage group composed of genes W, X, Y and Z was found to show the following gene combinations.

(All recombinations are expressed per 100 fertilized eggs). Construct a gene map. Determine the sequence of genes on the chromosome.
Biology
1 answer:
Gelneren [198K]3 years ago
7 0

Complete question:

For a series of experiments, a linkage group composed of genes W, X, Y and Z was found to show the following gene combinations. (All recombinations are expressed per 100 fertilized eggs). Construct a gene map. Determine the sequence of genes on the chromosome.

  • w-x = 5
  • w-y = 7
  • w-z = 8
  • x-y = 2
  • x-z = 3
  • y-z = 1

Answer:

The sequence of genes on the chromosome is:

----W-------------------------X-----------Y------------Z---

Explanation:

First, we need to know that 1% of recombination frequency = 1 map unit = 1cm. And that the maximum recombination frequency is always 50%.  

The map unit is the distance between the pair of genes for which every 100 meiotic products, one results in a recombinant one.  

The recombination frequencies between two genes determine their distance in the chromosome, measured in map units. So, if we know the recombination frequencies, we can calculate distances between the four genes in the problem and we can figure the genes order out. This is:

Recombination frequencies:  

1% of recombination frequency = 1 map unit (MU)

  • w-x = 5 MU
  • w-y = 7 MU
  • w-z = 8 MU
  • x-y = 2 MU
  • x-z = 3 MU
  • y-z = 1 MU

Now that we know the distances, we just need to analyze them to find out the correct order of the genes. First, we can look for the biggest distance, which tells us which genes are located in the extremes. w-z distance is the biggest one, so these two genes are in the extremes of the chromosome segment. ---W----------------------------------------------Z---

                     ∫---------------------8 mu-------------------∫

The rest of the genes are located in the middle between these two.

The second biggest distance is between w-y (7 mu). Y is also 1mu distant from Y. 7 mu + 1 mu = 8 mu. So, Y is located closer to Z.

---W-------------------------------------Y------------Z---

    ∫-----------------------7 mu---------∫∫---1 mu--∫

    ∫---------------------8 mu-------------------------∫

w-x = 5 mu, and x-y = 2mu, so x is located between w and y. The sum of these distances equals the distance w-y ( 5 mu + 2 mu = 7 mu). So,

---W-------------------------X----------Y------------Z---

    ∫-----------5 mu -------∫∫--2mu--∫

    ∫-----------------------7 mu---------∫∫---1 mu--∫

    ∫---------------------8 mu-------------------------∫

We know that the distance between x-y equals 2, and the distance between y-z equals 1. Also, the distance between x-z equals. This leads us to assume that Y is located between X and Z.

----W-------------------------X-----------Y------------Z---

    ∫-----------5 mu -------∫∫--2mu--∫∫----1mu---∫

                                     ∫------ 3 mu-----------∫

    ∫-----------------------7 mu---------∫∫---1 mu---∫

    ∫---------------------8 mu--------------------------∫

   

You might be interested in
From his monohybrid crosses, Mendel developed his first law
Nikitich [7]

Answer:

Im confused but if your asking for Medel's first law it would be states that for the pair of alleles an individual has of some gene (or at some genetic locus), one is a copy of a randomly chosen one in the father of the individual, and the other if a copy of a randomly chosen one in the mother, and that a randomly chosen one will be copied

Explanation:

4 0
2 years ago
Can someone rephrase this "The climate in the boreal forest is characterized by long, very cold, dry winters and short, cool, mo
Arte-miy333 [17]

Answer:

"Long, bitterly cold, dry winters and short, cool, damp summers define the boreal forest climate. The boreal forest is alive with activity. In the winter, their conical forms decrease snow buildup on branches, preventing them from breaking under the weight of the snow."

Explanation:

Hope this helps! :)

6 0
2 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
DNA is copied in a process called:
d1i1m1o1n [39]

Answer: Transcription

Explanation:

Transcription is the process by which DNA is copied (transcribed) to mRNA, which carries the information needed for protein synthesis. ... The pre-messenger RNA is then "edited" to produce the desired mRNA molecule in a process called RNA splicing.

4 0
2 years ago
PLEASE HELP!!! WILL GIVE BRAINLIEST!!!
iren [92.7K]

Answer:

the answer is B

Explanation:

As it releases so does the potassium ions

6 0
2 years ago
Other questions:
  • The pair of population graphs below display the results of two different five-year hunting cycles, one on light trees and one on
    5·2 answers
  • f a scientist is observing biotic and abiotic factors, which of the following level of organism must she be studying? A. A popul
    7·1 answer
  • Seasonal variations in ocean temperatures can impact the populations of living organisms in the ocean. How would a phytoplankton
    5·1 answer
  • Emily is learning about the body systems and their functions. Which body 10 points
    15·1 answer
  • What is the term for all of the population in a particular region
    15·2 answers
  • Into what structure does the embryo excrete wastes on reptiles
    14·1 answer
  • Currently, there are no known risks in genetically modifying crop species. TRUE FALSE
    10·1 answer
  • Which phrase best defines a galaxy?
    10·2 answers
  • Drag each tile to the correct box.
    11·1 answer
  • Between which two atoms of water are hydrogen bonds are formed?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!