1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rzqust [24]
2 years ago
7

Which factors that affect personal health are the most easily controlled?

Biology
2 answers:
algol [13]2 years ago
8 0
Its C because your lifestyle is a choice
pogonyaev2 years ago
7 0

Answer:

c. lifestyle

Explanation:

There are many things that can affect a person's health but not all can be controlled. For example, genetics are what people are born with and cannot be changed. Additionally, global and environmental situations can change but it takes an entire community; so, one individual cannot change these factors. However, one person can change their own lifestyle, assuming they have the willpower.

You might be interested in
When you climb a rope you change blank energy into blank energy
mash [69]
Chemical energy into  kinetic energy
3 0
3 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
​lewin's three-step process is consistent with​ ________ theory of organizational change.
Flura [38]
Calm waters <span>theory of organizational change</span>
5 0
3 years ago
Why are vegetables considered among the most nutritious foods available?
Svetradugi [14.3K]

Vegetables are considered among the most nutritious food available because they have a large amount of minerals and vitamins in them.They do not have fat in them which makes is more nutritious.Besides this every part of vegetable can be utilized whether it is in the form of stem,root,leaves,seed all have some amount of nutrition in them.The nutrition present in vegetables can be derived in multiple ways ,they can be eaten raw or can be cooked.Vegetables are very rich source of vitamins and minerals. They are very rich in anti-oxidants ,which protects the body from cancer.They are also a rich source of iron,phosphorous,multivitamin,etc.

7 0
3 years ago
What is the difference between immune deficiency and opportunistic infection?
RoseWind [281]

Answer:

Immunodeficiency disorders prevent your body from fighting infections and diseases. This type of disorder makes it easier for you to catch viruses and bacterial infections. Immunodeficiency disorders are either congenital or acquired. A congenital, or primary, disorder is one you were born with.  whereas Opportunistic infections (OIs) are infections that occur more frequently and are more severe in people with weakened immune systems, including people with HIV. Many OIs are considered AIDS-defining conditions.

hope it helps please mark me br-

well you know what i mean : )

Explanation:

8 0
3 years ago
Other questions:
  • If a single mutation turns off the growth of some pairs of legs within an organism, what's most likely affected
    5·1 answer
  • What is the average life expectancy for someone with HIV? Does life expectancy differ around the globe?
    12·1 answer
  • Glycolysis is an example of a metabolic pathway that is utilized by all human body tissues. Other pathways are much more promine
    10·1 answer
  • Why is it difficult to grow anaerobes in vitro?
    9·1 answer
  • Which of the following must occur for speciation to happen?
    10·1 answer
  • Which labels best complete the flow chart?
    7·2 answers
  • How does the large amount of DNA fit into the tiny nucleus within the microscopic cells?
    9·2 answers
  • An interaction in which one organism captures and feeds on another organism is called
    12·2 answers
  • The photo shows a boy and his parents.
    9·1 answer
  • What was Frank’s body temperature before thrax entered?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!