1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
3 years ago
11

Which statement correctly describes a level of organization in the human circulatory system?

Biology
1 answer:
pickupchik [31]3 years ago
7 0
Organs are made up of many tissues
You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
H
Anit [1.1K]

Answer:

Law of dominance

Explanation:

It just it

3 0
3 years ago
How do pockets increase a lung´s surface area?
icang [17]

Answer:

many alveoli are present in the lungs with a shape that further increases surface area. Thin walls - alveolar walls are one cell thick providing gases with a short diffusion distance. Moist walls - gases dissolve in the moisture helping them to pass across the gas exchange surface.

Explanation:

8 0
3 years ago
The row of energy in a grassland ecosystem is shown
bixtya [17]

The populations with the trophic levels that receive the least amount of the total energy from the grass would be Hognose snakes and owls.

<h3>Trophic Level</h3>

The higher we move up a trophic level, the lower the amount of energy transferred from the previous levels.

More precisely put, only about 10% of the total energy available at one trophic level is transferred to the next while the rest is lost as heat to the surrounding.

In this case, Hognose snakes and owls represent the two highest trophic levels in the ecosystem. Thus, their populations would receive the lowest amount of energy from the producer, the grass.

More on energy transfer in trophic levels can be found here: brainly.com/question/13267087

8 0
2 years ago
Which changes would make Earth cooler?
Mrac [35]
Increasing cloud cover, since it’ll block off any sunlight
8 0
2 years ago
Other questions:
  • If the fibers of a muscle are running caudoventrally, in which direction aRE they running?
    7·1 answer
  • Which enzyme would most likely function in the stomach ?
    14·2 answers
  • Oof i kinda need help on this :)
    15·2 answers
  • Will mark Brainliest.
    7·1 answer
  • The American colonists' seven-year fight for independence from Great Britain waIs called?
    6·1 answer
  • A scientist bred fruit flies in two separate containers with different food sources for many generations. When she put the fruit
    6·2 answers
  • Why do researchers think that seals use visual cues to<br> navigate?
    9·1 answer
  • The __________ is the upper boundary surface of the zone of saturation.
    7·1 answer
  • Please someone help me ASAP please
    15·1 answer
  • Plsss heeeeeeeeeeeeeeeeeeeelp
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!