1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stira [4]
2 years ago
6

Please help me with this I would greatly appreciate it!

Biology
2 answers:
Romashka [77]2 years ago
7 0

Answer:

WHAT DO YOU NEED HELP

Explanation:

Wewaii [24]2 years ago
3 0
The correct answer should be B. it is likely that an earthquake with magnitude greater than 7.0 will occur sometime in the not-too-distant future. i hope this helps :)) if it’s right pls mark me brainliest
You might be interested in
Planets are classified in yhe domain _____<br>A. archaea<br>B. bacteria <br>C. eukarya​
Gelneren [198K]

Archaea means ancient, bacteria are, well, minuscule organisms that live everywhere, and eukarya are organisms with cells that have a nucleus as well as membrane-bound organelles... my best guess if it is planets you mean, then the answer would be archaea, if it is plants, like flowers or such, then it is eukarya.

I hope this helps!

3 0
3 years ago
Read 2 more answers
What part of the female system is the usual site of fertilization of the ovulated oocyte?.
Paul [167]

Fertilization of the egg cell by the sperm usually takes place in the fallopian tube. The fertilized egg then travels to the uterus and implants in the endometrium.

<h3>What are fallopian tubes?</h3>
  • Fallopian tubes are also called oviducts or uterine tubes. It is the passage through which the egg enters the uterine cavity from the ovary.
  • Fallopian tubes are part of the reproductive tract. They have a smooth muscle wall, an inner mucous membrane, and an outer layer of loose supporting tissue (serosa).
<h3>Why does fertilization take place in the fallopian tubes?</h3>

The fallopian tube (oviduct) regulates fertilization through sperm induction and sperm hyperactivity. Sperm induction is achieved by rheotaxis, thermotaxis, and chemotaxis. Rheotaxis is caused by tubal fluid that creates a current flow from the tubal ampulla to the tubal isthmus.

To learn more about fallopian tubes visit:

brainly.com/question/12711470

#SPJ1

8 0
1 year ago
Identify the neurons described
rosijanka [135]

Answer:

<u>Motor neurons </u>send messages to the muscles and glands to respond to stimuli.

<u>Sensory neurons </u>move information towards the central nervous system for processing.

<u>Interneurons </u>carry information from one type of neuron to another.

Explanation:

  • Neurons are basic structural and functional units of Nervous system.
  • Neurons possess electrical excitability, the ability to respond to a stimulus and convert it into a action potential.
  • Neurons can be classified on the basis of their structure and function.
  • On the basis of structure neurons are classified as, Multipolar neuron;Bipolar neuron; Unipolar neuron.
  • On the basis of function neurons are classified as, Afferent or sensory neuron; Efferent or motor neurons; Interneurons or association neurons.
3 0
3 years ago
which humans control breeding of other organisms to favor certain traits, it is reffered to as___. a) natural selection b) artif
fgiga [73]
<span>Which humans control breeding of other organisms to favor certain traits, it is referred to as artificial selection.</span>
6 0
2 years ago
Read 2 more answers
Which type of star cluster is loose and disorganized?​
andriy [413]

Answer:

open cluster

Explanation:

As the name suggests, an open cluster is a star cluster that is loose and disorganized.

8 0
3 years ago
Read 2 more answers
Other questions:
  • BRAINLEST
    9·2 answers
  • Hormones released during exercise that can cause a person to get a "physical high" are known as
    13·1 answer
  • Which of the following adaptations does not protect tundra organisms from heat loss?
    13·1 answer
  • Photosynthesis takes place in plants and plant like organisms. What do plants absorb from the air? Why is this
    9·2 answers
  • 18. Identify the term that correctly identifies the sentence.
    9·1 answer
  • What is an example of codominance?
    14·2 answers
  • What are 3 domains of organism?
    15·2 answers
  • What type of cells are produced during meiosis?
    12·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Define classification.<br> (In biology)
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!