1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadezda [96]
3 years ago
12

Most organs and organ systems are only made of one type of tissue. True Or False

Biology
1 answer:
Ksivusya [100]3 years ago
4 0
The answer to this is true
You might be interested in
A scientist wishes to learn about volcanoes and earthquakes. Which of the following spheres should she most directly study?
Vera_Pavlovna [14]
The answer is D.geosphere(rock)

hope this helps
7 0
3 years ago
Read 2 more answers
Which of these is an environmental cost of tar sands extraction? A. Acid rain
Verizon [17]

Answer:C habitat loss

8 0
3 years ago
How has genetic engineering helped farming?
Alina [70]

Answer:

increases in crop productivity brought about by genetic engineering can help relieve problems faced by farmers by decreasing the losses caused by pests, disease, weeds,

Explanation:

3 0
3 years ago
Place these in order
svetoff [14.1K]

Answer:

The correct order would be:

Water evaporates from a lake.

↓

Water vapor condenses to form clouds.

↓

Water falls as rain, snow, and sleet.

↓

Water flows down mountains and hills.

↓

Water joins streams or forms groundwater.

Water cycle refers to the cyclic movement of water in an environment. The water passes through various stages, namely:

evaporation and transpiration

condensation

precipitation

run off

Explanation:

4 0
3 years ago
Read 2 more answers
4. A(n) ______, such as a pigeon, is an organism that gains body heat primarily from its own metabolism.
hammer [34]

The answer is endotherm.

3 0
3 years ago
Other questions:
  • What is the definition of antigen
    8·1 answer
  • Suggest why captopril or other ACE inhibitors might fail to lower a patient's blood pressure?
    15·1 answer
  • Metallic ions or cations are __________ charged ions. positively negatively neutrally
    13·2 answers
  • Which of these describes a quantitative observation?
    8·1 answer
  • The hippocampus, amygdala, and hypothalamus are part of the
    5·1 answer
  • How do scientific models provide a practical solution for some types of research? Check all that apply.
    11·1 answer
  • An organism has 50 chromosomes in its body cells, how many chromosomes are in it’s sex cells?
    5·2 answers
  • 2.Which of the following is the appropriate time for pruning fruit trees?
    5·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Describe how the force of gravity acts upon an object, and give an example. btw this is 5th grade i just copied and paste what m
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!