Answer:
Tolerance to heat, light and parasite.
Explanation:
Characteristics of tolerance to heat, light and parasite are the three reasons that might use a higher percentage of Nguni on the sector of livestock farmers in South Africa in 2003. The temperature of South Africa is extremely high which can be tolerated by the Nguni cattle due to its good characteristics. The Nguni cattle can bear extreme temperature, high intensity of light and resistance to parasites make it best suited for that environment.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
recombinant DNA
A strand of DNA formed by splicing DNA from 2 different organisms is called recombinant DNA
Explanation:
Using the techniques of recombinant DNA technology, certain enzymes known as restriction enzymes capable of cleaving double stranded DNA in the plasmid of bacteria genomes (other organisms like eukaryotes can also be used) are used to obtain specific sequences of DNA bearing desirable traits in the both organisms.
Once the two DNA fragments have been obtained, another enzyme known as DNA ligase is used to seal the point of splicing, thereby constructing a single DNA from the two organisms.
This single DNA is known as Recombinant DNA
Answer: Skunk
Explanation: The panda will try to use their slow attack, but the skunk will counter it with their stinky spray that smells bad and the panda will run away.
