1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nordsb [41]
3 years ago
5

Which organisms are not necessary for secondary succession to begin?

Biology
2 answers:
Blababa [14]3 years ago
5 0
I believe plants would be the answer
Korvikt [17]3 years ago
4 0
The first inhabitants are lichens or plants.
You might be interested in
An adventurer has lost his way in jungle . He lost his watch . Suggest an instrument that can help him to estimate time accurate
valentinak56 [21]
My first thought would be to use the light in the sky for help. stars and moon as night and sun as day, you can tell by when the sun rises and moves.
6 0
3 years ago
Read 2 more answers
At which of these locations is a dietician least likely to work? school theater hospital nursing home
ddd [48]
Hey @Cari552!

A dietician is an expert in human nutrition the regulation of one's diet. A Dietician can be found in schools - educating kids on their diets. A Dietician can be found in hospitals - helping patients. A dietician can also be found in a nursing home, helping the elderly. Therefore, a dietician would be least likely to work in a theater!

Hope this helps! 
5 0
4 years ago
Read 2 more answers
Which would best allow a species to survive environmental changes? O A small population VE O B genetic diversity C. similar phys
kvv77 [185]

Answer:

B

Explanation:

6 0
3 years ago
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
What is an easy definition for prokaryote and eukaryote? PLEASE ANSWER MY ASSIGNMENT IS DUE TODAY
solong [7]

Answer:

prokaryote- a microscopic single-celled organism that has neither a distinct nucleus with a membrane nor other specialized organelles. Prokaryotes include the bacteria and cyanobacteria.

eukaryote- an organism consisting of a cell or cells in which the genetic material is DNA in the form of chromosomes contained within a distinct nucleus. Eukaryotes include all living organisms other than the eubacteria and archaebacteria.

Explanation:

8 0
3 years ago
Other questions:
  • Which sense can distinguish between five different types?
    8·2 answers
  • Oils are generally ________ at room temperature and are obtained from ________. oils are generally ________ at room temperature
    9·1 answer
  • What is the main difference between the humoral immune response (HIR) and cell-mediated immune responses (CMIR)?
    10·2 answers
  • Can the scientific method be used to prove unique historical events?
    6·2 answers
  • The graph above shows the progress of an enzyme-catalyzed chemical reaction. Based on the graph, this enzyme
    6·2 answers
  • FREE POINTS 3!!
    9·2 answers
  • How do you know the molcule below is saturated fat
    5·1 answer
  • The diagram below shows the layers of a rock having a trilobite:
    10·2 answers
  • 14 Pierre is studying the organs in the human digestive system. He looks at a
    11·1 answer
  • Please answer quickly :)
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!