Yes our lungs will be clean and perfect.
Answer:
all of the above
Explanation:
All the statements are true that is Sweating is an example of positive feedback because when you sweat your body becomes hot and your inner body becomes cool. Shivering is an example of negative feedback because shivering occurs when there is cold in the body and can lead to sickness. The nervous system is responsible for sensing changes in the environment because it is responsible for sensing what's going on in our body.
The answer would be D.
HWE states that genotype and allele frequencies in a population remain constant from generation to generation when evolutionary influences are absent(such as gene flow or natural selection).
Answer:
B he proved that the heliocéntrico model accurately described tour solar system
Explanation:
des
i think
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)