1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liula [17]
3 years ago
15

Which geometric solid is the best model for the cell in the bottom two layers of cells?

Biology
2 answers:
nevsk [136]3 years ago
6 0

Answer:

The correct answer is option D. cube.

Explanation:

The image represent the cells similar to the epithelial cells whcih is found in various tissues such as muscle, nervous and many more. These cells are found in cuboidal, columnar and squamous sha[es which found in normally double layer or in multiple layers.

These cells are cube like in structure with a spherical nucleus present in the center of the cell known in assocation of various cells.

Korolek [52]3 years ago
5 0

which geometric solid is the best model for the cell in the bottom two layers of cells?

a. a sphere

b. a flat disk

c. a square pyramid

d. a cube

Answer: Cube

You might be interested in
Could life as we know it exist if the air on earth only contained oxygen?
Blizzard [7]
Yes our lungs will be clean and perfect.
3 0
3 years ago
Read 2 more answers
Which of the following statements is true? Sweating is an example of postive feedback. Shivering is an example of negative feedb
Alexandra [31]

Answer:

all of the above

Explanation:

All the statements are true that is Sweating is an example of positive feedback because when you sweat your body becomes hot and your inner body becomes cool.  Shivering is an example of negative feedback because shivering occurs when there is cold in the body and can lead to sickness. The nervous system is responsible for sensing changes in the environment because it is responsible for sensing what's going on in our body.

4 0
3 years ago
Read 2 more answers
The frequency of alleles in a population that is in hardy Weinberg equilibrium?
maksim [4K]

The answer would be D.

HWE states that genotype and allele frequencies in a population remain constant from generation to generation when evolutionary influences are absent(such as gene flow or natural selection).

7 0
4 years ago
What was Edwin Hubble's contribution to the field of astronomy?
erastova [34]

Answer:

B he proved that the heliocéntrico model accurately described tour solar system

Explanation:

des

i think

3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • What is a baseline for an experimental investigation?
    13·1 answer
  • The carbon to produce carbohydrates in the second stage of photosynthesis comes from
    10·1 answer
  • If a protein in your body was denatured (broken down, or changes shape) because of high temperatures or a change in ph, what eff
    10·1 answer
  • What statement is true regarding the nervous and endocrine systems?
    8·1 answer
  • Why are matter cycles important in an ecosystem??ASAP!!!
    5·1 answer
  • PLEASE HELP ITS DUE NOW
    9·1 answer
  • The amount of strain placed on blood vessels as blood moves through them is known as
    6·1 answer
  • Which element would enable a geologist to determine the absolute age of the rock?
    10·2 answers
  • Which of the following is a change that could be passed on to an organism’s offspring?
    8·1 answer
  • Hemispheric specialization makes having a stroke on the ________ side of the brain _________ to recover from than the opposite s
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!