1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Volgvan
3 years ago
5

What is the slope of the line that goes through (2,6) and (4,5)

Mathematics
1 answer:
Lesechka [4]3 years ago
3 0

Answer:

-1/2

Step-by-step explanation:

You find the change in the y coordinates. 6 -> 5 is -1. Now the same for the x. 2 -> 4 is +2. now place them in a fraction with the y/x -1/2. if both were negative then you would just cancel out the negatives.

You might be interested in
Lisa's penny bank is
Bingel [31]
1200 pennies!!!!!!!!!
8 0
4 years ago
Solve by the addition method
Sladkaya [172]
Answer is no solution I believe
7 0
4 years ago
What is 3х – 18y = 4
kow [346]

The answer is no solution

3 0
3 years ago
Read 2 more answers
Suppose that each semester at a particular community college Manuel has to pay $1478 in tuition and $121 in fees.
Kamila [148]

Answer:

Step-by-step explanation:

<em>Let x be time, in semesters, remaining before Manuel graduates</em>.  We find that Manuel's expenses are:

$1478/semester in tuition, and

$121/semester in fees

1.  <u>x semesters remaining:  fees</u>

  Remaining cost for fees, y, is the product of the fee times the number of semesters, x:

y =($121/semester)*x

y = ($121)*x

2.  <u>x semesters remaining:  tuition</u>

  Remaining cost, y, is the product of the tuition (times the number of semesters, x.  

y = ($1478/semester)*x + ($121/semester)*x

y = ($1599)*x

3.  <u>x semesters remaining:  tuition and fees</u>

  Remaining cost, y, is the sum of the products of the tuition (times the number of semesters, and the fees (tix.  

y = ($1478/semester)*x + ($121/semester)*x

y = ($1599)*x

5 0
1 year ago
Help me please ( on the image )
Mrac [35]

Answer:

\frac{\pi}{3} radians

Step-by-step explanation:

Number of hours on a clock = 12

Since, measure of a circle at the center = 360°

Measure of central angle formed by the arc between each number (representing hours) = \frac{360}{12}

                                  = 30°

Central angle formed by the arc intercepted by the hands of the clock at 8:00 = 4 × 30°

        = 120°

Therefore, angle measure in radians = \frac{\pi }{360}\times (120^0)

                                                              = \frac{\pi }{3}

Angle formed by the hands of the clock at 8:00 = \frac{\pi}{3} radians

6 0
3 years ago
Other questions:
  • How to simplify (81^-0.25)^3
    12·1 answer
  • The length of a rectangle is 13 centimeters less than six times its width. Its area is
    15·1 answer
  • The first step in solving the quadratic equation -5x^2+8=133 is to subtract 1.)2 from each same side
    15·2 answers
  • What's the answer?<br><br><br> (x – 2) (3x-4)
    14·2 answers
  • Need help with this one question, please also try to explain.
    6·2 answers
  • What is 14 14/15 as a demical
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • The lengths of the sides of a triangle are represented by 25 cm, 20 cm, and 17 cm. What is the perimeter of the triangle?
    12·2 answers
  • A rectangle has and area of 55 Square inches and a length of 5 inches what is the width
    11·1 answer
  • TIME SENSITIVE!!! What will the first row of this multiplication be? (first image is the problem, second is the options)
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!