1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexxx [7]
3 years ago
7

How does carbon cycle through Earth's systems? A. As fossil fuels are burned, carbon dioxide is made available for photosynthesi

s in animal cells. When the animals die, carbon is released into the soil, and the animal remains form new fossil fuels. B. Animals absorb carbon dioxide through their skin. Dead animals release carbon into the soil. Plants absorb the carbon from the soil and release carbon dioxide during photosynthesis. C. Plants absorb carbon dioxide through their leaves. Animals take in the carbon when they eat the plants. Animals exhale carbon dioxide. Dead plants and animals release carbon into the soilling D. Photosynthesis releases carbon dioxide into the atmosphere Cellular respiration uses carbon dioxide​
Biology
1 answer:
Strike441 [17]3 years ago
6 0

Answer:

D. Photosynthesis releases carbon dioxide into the atmosphere Cellular respiration uses carbon dioxide​.

Explanation:

Carbon dioxide is taken out of the air by the photosynthesis process to make carbon food for crops.

Animals and plants need a mechanism called respiration to remove carbon dioxide gas.

When combustibles are burned, carbon flows from fossil fuels to the air.

You might be interested in
This describes the dynamic changes between sedimentary metamorphic and igneous substances
rodikova [14]

Answer:

This is a solid substance that is composed of minerals. This describes the dynamic changes between sedimentary, metamorphic, and igneous substances. This occurs are mid-ocean ridges where a new oceanic crust is formed and then slowly moves away from the ridge.

Explanation:

4 0
3 years ago
Read 2 more answers
I neds help plez! I can't figure this out
vitfil [10]

Answer:

A. 9

Explanation:

4 0
3 years ago
Veins carry blood ________ the heart.
kykrilka [37]

veins carry deoxygenated blood back to the heart.

3 0
3 years ago
Read 2 more answers
The Sun and stars do not move.<br> T or F
Sidana [21]

False both the sun and the stars change and move around.

8 0
3 years ago
Read 2 more answers
Which of the following gases is formed during photosynthesis?
katrin2010 [14]

Answer:

oxygen

Explanation:

6 0
3 years ago
Other questions:
  • The selective breeding of wild mustard has _________ _________ and produced at least four other vegetable crops.
    5·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • D)
    15·1 answer
  • 10 Which kingdom(s) include both unicellular and multicellular organisms?
    6·2 answers
  • Members of which phylum contain stinging capsules that poison the entangled prey?
    11·2 answers
  • When the cell cycle is interrupted what is the end result
    15·1 answer
  • Which is an example of an animal responding to an external stimulus?
    15·2 answers
  • Function of trichocyst
    9·1 answer
  • Mitosis and cytokinesis divide a —— cell into
    12·1 answer
  • Fossil evidence has been used to understand the movement of continental plates. The figure below shows where fossils of several
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!