1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ratelena [41]
3 years ago
15

—-PLEASE HELP QUESTION IS IN THE PICTURE—-

Biology
1 answer:
spin [16.1K]3 years ago
7 0

Answer: B is correct

Explanation:

You might be interested in
Which best describes why scientists need to be creative? A. They need to be sure that the evidence backs up the conclusion. B. T
lisabon 2012 [21]

Answer: D, They need to think of ways to solve problems.

Explanation:

5 0
3 years ago
Conjugation is the direct transfer of dna from one bacterium to another. occurs when a phage transfers bacterial dna from one ba
Reptile [31]
Conjugation is the direct transfer of DNA from one bacterium to another.
Bacteria can exchange genetic information through three different mechanisms; conjugation, transduction, and transformation. Bacterial conjugation involves the transfer of a plasmid from one bacterium to the other, through cell-to-cell contact. Bacterial transduction is performed through bacteriophages. Bacterial transformation refers to the process of moving genetic elements to various positions of the genome.

7 0
4 years ago
The parts of an organism’s environment that are living or once living, and interact with the organism are
rodikova [14]

Answer:

An organism interacts with both the living and nonliving parts of its habitat.

Explanation:

Biotic FactorsThe parts of a habitat that are living, or once living, and that interact with an organism are called biotic factors.

7 0
3 years ago
Which series lists the structural components of the light dependent reactions in order from smallest to largest
hichkok12 [17]

Answer:

Chlorophyll >thylakoid> grana >chloroplast.

Explanation:

5 0
4 years ago
Read 2 more answers
List names of marine invertebrates!
ladessa [460]

Answer:

sponges, cnidarians, marine worms, lophophorates, mollusks, arthropods, echinoderms and the hemichordates.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is true of all organisms belonging to the kingdom Animalia?
    9·2 answers
  • Why are organelle important for cell homeostasis
    14·1 answer
  • Why are bananas chronically yellow
    8·2 answers
  • How does climate influence humans
    6·1 answer
  • Seasonal conditions influence the life cycle of marine organisms. Many animals that inhabit lakes have a reproductive process th
    5·2 answers
  • Which part of a DNA molecule carries the genetic instructions that are unique for each individual: the sugar-phosphate backbone
    12·1 answer
  • Genetic diversity is the variation in the genes of an entire species. Each circle represents a population of a particular specie
    11·2 answers
  • A number of similar families make up a(n) _____.
    15·1 answer
  • What would you do during a zombie apocalipse
    5·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!