1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KatRina [158]
3 years ago
9

If CO2 is a molecule, how many TOTAL atoms is it made up of?

Biology
2 answers:
Schach [20]3 years ago
6 0

Answer: No number means one atom. For CO2 there is one atom of carbon and two atoms of oxygen. For H2O, there is one atom of oxygen and two atoms of hydrogen. A molecule can be made of only one type of atom.

charle [14.2K]3 years ago
5 0

Answer:

Carbon dioxide, CO2, is a chemical compound composed of two oxygen atoms and one carbon atom.

Explanation:

You might be interested in
Divide. Write your answer in simplest form. 8÷4/3​
telo118 [61]

Answer:

.66666666 or 1/3

Explanation:

3 0
3 years ago
Read 2 more answers
If you have B- blood, which blood types could you receive in a transfusion?
Vladimir79 [104]

Answer:

If you have type B blood, you should only receive types B or O blood.

Explanation:

7 0
3 years ago
Read 2 more answers
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
Carefully analyze the above chart. After a natural disaster takes place, which of the following sequences best identifies
iragen [17]

Answer: D. emergency, restoration, reconstruction

Explanation: found it in the textbook

7 0
3 years ago
Which of the following describes an ADP molecule?
Sveta_85 [38]

Answer:

The correct answer is -

ADP has less potential energy than ATP

ADP can be created when an ATP breaks or releases a phosphate bond.

Explanation:

ADP is adenosine diphosphate which means adenosine bound with a sugar molecule and two groups of phosphate molecules that also play an important role in cellular energy flow like ATP.

In ATP, there are three phosphates and two high energy bond that provides much energy in breaking whereas, in ADP, only one high energy bond and two phosphates present there.

When an ATP molecule breaks or releases one of its Phosphoanhydrous bonds and release energy and one of the phosphate groups, adenosine diphosphate or ADP created.

7 0
3 years ago
Other questions:
  • Genetic information is transmitted from DNA to
    11·1 answer
  • How does the plant get all of the reactants needed for photosynthesis?
    8·1 answer
  • When water boils, some of its particles have enough energy to overcome attractive forces from neighboring particles. Where do th
    10·1 answer
  • Pistol shrimp and gobies depend on each other for shelter and protection. They have a beneficial relationship with each other. W
    6·1 answer
  • Photosynthesis is a biological process in which plants convert carbon dioxide gas to carbon compounds, such as glucose. The proc
    8·2 answers
  • Quais são os estímulos que o ambiente promove para estimular os nossos sentidos?
    6·1 answer
  • 1. Did your buoy move as you expected? Explain why or why not.
    10·2 answers
  • Enzymes in the human body work in a very wide range of conditions. <br> a. True<br> b. False
    13·1 answer
  • Which best represents an example of carbon fixation?
    5·2 answers
  • What do we call the tiny openings in a
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!