Answer:
If you have type B blood, you should only receive types B or O blood.
Explanation:
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer: D. emergency, restoration, reconstruction
Explanation: found it in the textbook
Answer:
The correct answer is -
ADP has less potential energy than ATP
ADP can be created when an ATP breaks or releases a phosphate bond.
Explanation:
ADP is adenosine diphosphate which means adenosine bound with a sugar molecule and two groups of phosphate molecules that also play an important role in cellular energy flow like ATP.
In ATP, there are three phosphates and two high energy bond that provides much energy in breaking whereas, in ADP, only one high energy bond and two phosphates present there.
When an ATP molecule breaks or releases one of its Phosphoanhydrous bonds and release energy and one of the phosphate groups, adenosine diphosphate or ADP created.
