1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tju [1.3M]
3 years ago
11

HELP HELP HELP BIG TEST PLZ HELP Njqqa ballz

Biology
2 answers:
Tju [1.3M]3 years ago
8 0
I got shot in the balls in the Hebrew morning and I got shot in the balls and green balls in my head lol I was in the balls and green balls in my pants lol I was going on the same but I’m going on a little later than that I got a little green balls in the
Dmitry_Shevchenko [17]3 years ago
8 0
Ballz balls balz BALLZ ballz and ballz
You might be interested in
Which of the following describes characteristics of the earth's crust
Burka [1]
What are the choices?
4 0
3 years ago
In what organ does most beta-oxidation take place
Rudiy27
In the inner mitochondrial membrane 
6 0
3 years ago
How is usable nitrogen obtained by anumals?
pickupchik [31]
Animals obtain nitrogen by eating plants which has absorbed nitrogen from the soil.
3 0
3 years ago
Read 2 more answers
In the “energizing stage” of the sliding filament theory of muscle contraction, ATP breaks down and releases energy to cause the
IgorC [24]
Calcium ions presents Ca+ binds to troponin which makes tropomyosin move out of way for myosin to attach. Cross-bridge attaches. ATP breakdown provides energy to ready the myosin head for a power stroke. Myosin head attaches to exposed binding site on actin and the power stroke is accomplished. Cross-bridge (Myosin head) springs from raised position and pulls on the actin filament. Cross bridges break, ATP binds to Cross-bridge (but is not yet broken down) Myosin heads are released from actin. As long as calcium ions and ATP are present, this walking continues until the musle fiber is fully contracted. Hope this helps!
5 0
3 years ago
In molecules of DNA the nitrogenous base guanine will only pair with
Elena-2011 [213]
In both DNA and RNA, guanine pairs with cytosine
7 0
3 years ago
Other questions:
  • Which is NOT a defining characteristic of a mineral?
    5·1 answer
  • If you crossed two heterozygous yellow-seed pea plants (genotypes aa), the relative frequency of:
    10·1 answer
  • No system is completely closed off from its surroundings
    15·2 answers
  • If a single species of squirrel evolved over time into 2 species on opposite sides of the grand canyon, we would call this an ex
    8·1 answer
  • ________ is the biological heritage (including physical characteristics such as one's skin color and associated traits) that peo
    5·1 answer
  • Where is a hormone’s site of action?
    13·2 answers
  • What are the 3 stages of aerobic respiration?
    11·1 answer
  • HELP ASAP I WILL GIVE BRAINLIST
    11·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Passive transport moves molecules_____their concentration gradient (its not move)
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!