1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elza [17]
3 years ago
5

How can we learn about life on early Earth?

Biology
1 answer:
Lapatulllka [165]3 years ago
6 0

Easy. HISTORY or GEOGRAPHY books of specific areas you want to know more about.

You might be interested in
The First line of defense in the immune system
Elenna [48]
I think it’s A blocking pathogen from entering block
7 0
2 years ago
What is the advantage of using STR for the identification of bodies from a mass disaster, such as the World Trade Center?
never [62]
The correct answer is C. Short tandem repeats are mostly different in unrelated peoples' DNA. Therefore, it is used to match the DNA of the people of the related family for identification of bodies, during a mass disaster like World Trade Centre. DNA from the nucleus is extracted in the process, and the STR containing regions are amplified and studied and can be matched with that of the relatives.
5 0
3 years ago
Observable characteristics in organisms are known as
bezimeni [28]
Observable characteristics would be referred to as "traits".
3 0
3 years ago
Read 2 more answers
Consider a population of 919 individuals, in which a locus G/C determines the pigmentation in snow rabbits. GG and GC carriers s
mixas84 [53]

Answer:

Frequency of recessive allele 0.61

Explanation:

Given -

Total Population size = 919

Number of individual with recessive genotype = 341

Frequency of recessive genotype

\frac{341}{919} = 0.37

Frequency of recessive allele = \sqrt{0.37}  = 0.609 = 0.61

Hence, option C is correct

4 0
2 years ago
Which is a benefit of getting information from a government website? A. The information usually advocates an individual's opinio
nignag [31]

Answer:

B. The information will be reliable

Explanation:

By elimination:

Information on government websites is usually impartial, so A is eliminated. Additionally, information on a government website is not necessarily easy to understand, so that choice cannot be the correct answer either. The only remaining choice is B, so it is correct.

3 0
2 years ago
Other questions:
  • Example of ecosystem?
    6·2 answers
  • The cephalic stage of digestion
    14·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What are the different forms of genes inherited from each parent
    13·1 answer
  • you've been assigned to observed the habits of the birds living in your neighbor hood . what tools might you take along
    14·1 answer
  • Chum salmon (Oncorhynchus keta) are born in freshwater environments and then migrate to the sea. Near the end of their lives, th
    6·1 answer
  • TRUE OR FALSE: Heritability is important for both natural and artificial
    6·1 answer
  • Which argument is true for the classical theory of criminology?
    15·2 answers
  • In a sample of bacterial DNA, 14% of the nitrogenous bases are thymine. About what percentages are the other nitrogenous bases?
    12·1 answer
  • How is the orientation of Earth's magnetism recorded in rocks on the ocean
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!