1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
CaHeK987 [17]
3 years ago
7

What fossil fuels were formed from buried remains of plants and animals that lived millions of years ago?

Biology
1 answer:
vlabodo [156]3 years ago
8 0

Answer:

Coal, crude oil, and natural gas are all considered fossil fuels because they were formed from the fossilized, buried remains of plants and animals that lived millions of years ago. Because of their origins, fossil fuels have a high carbon content.

Explanation:

You might be interested in
Which of these is not a property of lymphatic capillaries?
Inessa05 [86]

Answer:

They are smaller than blood capillaries.

Explanation:

Lymphatic capillaries drains the extracellular fluid present between the cell spaces. The fluid is known as lymph as it enters the lymph capillaries. These capillaires drains into lymph vessels that drains to lymph nodes and lymph ultimately enters the venous circulation.

Lymphatic capillaries are slightly larger than blood vessels and these capillaries have close ends. The walls of lymph capillaries are made up  of endothelial cells. The endothelial cells overlap in lymph vessels and when the pressure in ECF is greater these cells move and create a sort of gap for the movement of ECF inside the lymph capillary but when the pressure inside the capillary is greater these cells again overlap and does not allow the lymph to move outside of capillary. Thus lymph capillaries only allow the ECF to enter the capillary but does not allow the lymph to go out from capillary. Lymph capillaries have greater internal pressure than blood vessels.

7 0
3 years ago
What is the difference between an cell and a tissue?
pogonyaev
The difference between a cell and a tissue is that tissue is made up of cells.
8 0
3 years ago
Read 2 more answers
In the lab, metabolic poisons can be used to study ATP synthesis and oxygen consumption. Many of these poisons have – or have ha
ivanzaharov [21]

Answer:

<em>Electron transport inhibitors: Cyanide, Rotenone</em>

<em> Uncoupling agents: trifluorocarbonylcyanide phenylhydrazone (FCCP)(FCCP)</em>

<em> ATP synthase inhibitors: Oligomycin</em>

<em> Transport inhibitors: Bongkrekic acid</em>

Explanation:

<em>Electron transport inhibitors: Cyanide, Rotenone</em>

Cytochrome oxidase also known as complex IV in the electron transport chain, carries electrons from cytochrome c to oxygen. It is a large enzyme having 13 subunits. Subunit  1 contains  two heme groups , a and a3. Electrons are tranferred from heme a to oxygen bound to heme a3. The reaction of cyanide with heme a3 blocks this process of eleron transport

.Rotenone blocks electron transfer at NADH dehydrogenase (NAD−Q(NAD−Q oxidoreductase) by preventing electron transfer from Fe-S center to ubiquinone.

<em> Uncoupling agents: trifluorocarbonylcyanide phenylhydrazone (FCCP)(FCCP)</em>

The transfer of electrons  from NADH through the respiratory chain to molecularoxygen is coupled to proton pumping from the inner mitochondrial matrix to the intermembrane space. This generates a proton motive force which is utilized in ATP synthesis. Trifluorocarbonylcyanide phenylhydrazone (FCCP)(FCCP) increases membrane proton permeability, causing protons to leak back into the mitochondrial matrix, thereby uncoupling the processs of ATP synthesis and proton flux.

<em> ATP synthase inhibitors: Oligomycin</em>

ATP synthase is the enzyme rensponsible for ATP synthesis. It has two functional domains,: F₁ and F₀. Oligomycin binds to F₀ and blocks the proton channel preventing rotation of the F₁ subuni, thus, preventing ATP synthesis from ADP.

<em>Transport inhibitors: Bongkrekic acid</em>

Adenine  nucleotide translocase is a transport protein that  transports free ADP from the cytoplasm into the mitochondrial matrix, while ATP produced from oxidative phosphorylation is transported from the mitochondrial matrix to the cytoplasm o the cell.

Bongkrekic acid inhibits Adenine nucleotide translocase, thus preventing ATP from leaving the mitochondria and starving cells of needed energy.

5 0
3 years ago
Albedo is the fraction of incoming light that is reflected by a celestial object. how would you predict a decrease in paved surf
iren [92.7K]

A decrease in the paved surfaces on earth will increase amount of light reflected or increase albedo.

<h3 /><h3>What is a paved surface?</h3>

A paved Surface refers to a surface covered by concrete, asphalt, masonry, or a similar material.

Paved surfaces have low albedo, that is they have low light reflectivity.

<h3>What is the effect of paved surface of Earth on albedo?</h3>

Since paved surfaces have low albedo, a decrease in the paved surfaces on earth will increase amount of light reflected (albedo).

Learn more about albedo here: brainly.com/question/14238698

#SPJ 1

8 0
2 years ago
Is the digestive system part of the excretory system? Why or why not?
Allisa [31]

The digestive system is parrallel to the excretory system, but not part of it. The digestive system is where the digestive process of getting energy from food. The excretory is where the blood enters the nephron. It filters out any kind of waste. The excretory is where the urine comes from. The digestive system doesn't produce urine. Urine is transported from the kidneys to the bladder. It does work together for the use of the body like basically everything in your body.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Please choose the answer that best completes the blanks of this sentence in the correct order. _______ are substances that provo
    6·1 answer
  • Match the following items. 1. semipermeable; allows certain substances to pass through plasma membrane 2. controls activities of
    13·2 answers
  • All cells types have the same function true or false
    13·1 answer
  • Petroleum fuels are considered nonrenewable resources because they are formed from __________ compressed between layers of rock.
    14·2 answers
  • Which of these conditions results in the formation of a bubo?
    13·1 answer
  • A sensory neuron is bathed in tetraammonium chloride and MgCl2, and then the voltage clamp is changed from -70 millivolts to -5
    10·1 answer
  • Tanisha says that the Moon looks dark from Earth when the Moon is in two different places: always when it is closest to the sun,
    12·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Show how Australia gets more UV light than Brazil by drawing the path UV waves take through the different materials that make up
    11·1 answer
  • Climate change may be harm for us justify?​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!