1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OleMash [197]
3 years ago
12

As with all multicellular organisms, homeotic genes in plants control morphogenesis (how the tissues and organs of the plant are

arranged). in maize plants, the homeotic gene knotted1 (abbreviated kn1) maintain the indeterminate state of shoot apical meristems. in wild-type maize plants, kn1 is expressed at high levels in the shoot apical meristem, but is expressed at low levels in leaves. in some mutant maize plants, kn1 is expressed at high levels in leaves. in those plants, outgrowths or knots of adventitious shoot meristems (shoot meristems that appear in abnormal locations on the leaves) form. use this information to determine which of the following statements are true. select the four statements that are true.
a. expression of the kn1 gene in shoot apical meristem cells produces a protein involved in the maintenance of shoot apical meristems.
b. in wild-type maize plants, the kn1 gene is mostly expressed in shoot apical meristem cells.
c. in mutant maize leaves, the kn1 gene is mostly not expressed.
d. leaves of the mutant maize plants produce more kn1 protein than leaves of wild-type maize plants.
e. both the wild-type and mutant maize leaves have the same morphology.
f. in wild-type maize plants, the kn1 gene is present in shoot apical meristem cells, but not in leaf cells.
g. in wild-type maize plants, the kn1 gene is expressed diferentially in shoot apical meristem cels and leaf cells.
Biology
1 answer:
joja [24]3 years ago
5 0

Answer:

a. True

b. True

c. False

d. True

e. False

f. False

g. True

Explanation:

The homeotic genes refer to evolutionarily conserved genes that modulate the development of different structures in organisms of the same groups (in this case, plants).  Moreover, homeobox genes are genes that encode transcription factors involved in the regulation of development in eukaryotic organisms. The knotted1 (<em>kn1</em>) gene is a plant homeobox gene is a member of the <em>kn1</em> homeobox (<em>knox</em>) gene family, which is responsible for maintaining indeterminacy and preventing cellular differentiation. In maize, <em>kn1</em> plays a key role in maintaining the cells of the shoot apical meristem in an undifferentiated state, being mainly expressed in shoot meristems during postembryonic stages of shoot development. It has been observed that maize mutant plants where <em>kn1</em> is ectopically expressed (i.e., in tissues in which this gene is not normally expressed) exhibit proximal-distal patterning defects.

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which of the following is true of an enzyme? (1 point) A.It catalyzes a series of reactions. B.It breaks down immediately follow
Elza [17]
It breaks down immediately,
4 0
3 years ago
The male reproductive parts of a flower are called
gulaghasi [49]
The correct answer in this question is letter B. The male reproductive parts of a flower are called stamens. It is composed of an anther and a filament. The pollen, which is located in the anther, contains the male reproductive cells.
7 0
3 years ago
Action potential propagation in a skeletal muscle fiber ceases when acetylcholine is removed from the synaptic cleft. Which of t
klasskru [66]

Answer:

a) Acetylcholine is degraded by acetylcholinesterase.

Explanation:

After it binds for its receptor on the plasma membrane of the postsynaptic cell, acetylcholine must be removed in order to prevent repeated stimulation. Acetylcholinesterase is enzyme for the inactivation of acetylcholine, present at all cholinergic synapses. This enzyme hydrolyses acetylcholine and breaks it to the acetate and choline. Choline can be reused for the synthesis of the new acetylcholine molecule so it is taken back into the presynaptic cell.

6 0
3 years ago
Could someone help : how does the number of offspring that are produced by an individual typically compare with the fecundity of
Rus_ich [418]

Answer:

The number of offspring produced is often related to the amount of parental care. Typically, the higher fecundity, the lower the amount of time parents devote to caring for the offspring.

7 0
3 years ago
Other questions:
  • People that are lactose intolerant their body does not produce enough of the enzyme lactase
    14·1 answer
  • Which phase of mitosis is shown in the diagram?
    14·1 answer
  • What is the purpose of operons in protein synthesis? They transfer the mRNA to the ribosomes for protein production. They unzip
    9·2 answers
  • Explain how scientists know that earth’s magnetic poles have reversed many times during earth’s history
    7·1 answer
  • Depolarization of a membrane can be induced by ________. Group of answer choices increasing its membrane's permeability to Na de
    11·2 answers
  • Which of the organisms in the table is (are) most similar to a tiger (Panthera tigris)? Explain.
    7·1 answer
  • Ige 1:
    9·1 answer
  • If you removed the tertiary consumers from a food web, what would be the response of the primary consumers
    6·2 answers
  • Which characteristic distinguishes the five groups of fungi?
    6·1 answer
  • PLEASE HELP ME!
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!