Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Plastic bags are made up of plastic film, non-woven fabric, or plastic textile. The molecules that are present in plastic bags are polymers. Polymers are large molecules made up of repeating units called monomers.
I know this isn't much, but I hope it helps! :)
Effect of increasing surface area on the rate of a reaction. ... Increasing the surface area of a solid reactant exposes more of its particles to attack. This results in an increased chance of collisions between reactant particles, so there are more collisions in any given time and the rate of reaction increases.
The 1st one. Fertilizers are like food for plants, and that's what an algae is, sorta. Trout's don't eat algae and if there's too much algae around, it gets dirty and they eventually die because of the amount of bacteria in the algae. It's the same thing if you have a fish tank.
Answer:
28 is great.......... it should be snSwer
