1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kvv77 [185]
2 years ago
13

According to the graph, how many billions of US dollars were invested in sustainable energy in 2006?

Biology
1 answer:
umka21 [38]2 years ago
5 0

Answer:

50

Explanation:        :)

You might be interested in
Which trace mineral is needed for the regulation of protein synthesis and reproduction and immune functions?A. ironB. zincC. cop
STALIN [3.7K]

Answer:

Zinc. (Ans. B)

Explanation:

Trace minerals: Trace minerals are defined as the inorganic molecules which are necessary for the human body for the different functions.

Zinc function in human metabolism is defined as a cofactor for numerous enzymes. Zinc play a role as a catalyst in a broad range of reactions. It is involved in the metabolic pathway directly or indirectly with lipids, carbohydrates, proteins, energy metabolism, and they are also important for the cell division process.

They also need for tissue and growth repair, and for reproductive development also. It's also played a vital role in immune system such as wound healing or required for the function and structure of the skin.

4 0
2 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
PLS HELP ME
shepuryov [24]

Answer:

a 25%

Explanation:

the white flower is the heterogeneous offspring and there is only 1 white so 100÷4 =25

6 0
3 years ago
A plant's stem _____.
Natali5045456 [20]

Answer:

All the above

Explanation:

A stem is one of two main structural axes of a vascular plant, the other being the root. It supports leaves, flowers and fruits, transports fluids between the roots and the shoots in the xylem and phloem, stores nutrients, and produces new living tissue.

Stems have four main functions which are:[1]

Support for and the elevation of leaves, flowers and fruits. The stems keep the leaves in the light and provide a place for the plant to keep its flowers and fruits.

Transport of fluids between the roots and the shoots in the xylem and phloem(see below)

Storage of nutrients

Production of new living tissue. The normal lifespan of plant cells is one to three years. Stems have cells called meristems that annually generate new living tissue.

3 0
2 years ago
Read 2 more answers
Is xylem a internal and external adaptation?
sergij07 [2.7K]
External adaption because it doesn’t adapt patterns
7 0
3 years ago
Other questions:
  • Suppose you are unable to remember any of the events or episodes of your life. this may be because of damage to your ____.
    7·2 answers
  • Think about water and how it rolls up on the beach. Think of all its qualities. Is it alive according to the characteristics of
    12·2 answers
  • The production of ________ , a protein that binds calcium in the intestinal cells, slows as a result of a vitamin d deficiency.
    5·1 answer
  • If eating chocolate affects total calorie consumption, then increasing the amount of chocolate a person eats will increase the a
    5·2 answers
  • A scientist observes that the electrical resistance of a superconducting material drops to zero when the material is cooled to v
    12·1 answer
  • What sphere does the ocean floor consist of?
    12·1 answer
  • A biologist at a highly prestigious biology conference presented an informative speech on how DNA in genetics works. All audienc
    8·1 answer
  • rachel's class is debating the impact of biotechnology on people, society, and the environment. Give one example of how biotechn
    13·1 answer
  • The haploid cells join during sexual reproduction are called _______?
    13·1 answer
  • I'm just asking this question cause I'm curious how long is a giraffes neck
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!