1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djyliett [7]
3 years ago
8

Can you elaborate on the reason disruptions of the cell cycle lead to many types of diseases such as cancer?

Biology
1 answer:
Naddika [18.5K]3 years ago
8 0

Answer:

If a checkpoint fails or if a cell suffers physical damage to chromosomes during cell division, or if it suffers a debilitating somatic mutation in a prior S phase, it may selfdestruct in response to a consequent biochemical anomaly.

You might be interested in
How does the Marburg virus compare to the coronavirus?
ahrayia [7]

Answer:

The Marburg virus wasn't mutating this early on, therefore the Coronavirus is much more deadlier and almost impossible to get a cure for, due to the rapid change in pathogens!

8 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Which of the factors below are used to classify the different organisms on Earth into domains and kingdoms?
Gnoma [55]
The answer is all of the above
8 0
3 years ago
Which gas production would you measure if you wanted to determine if cell respiration was taking place?
Illusion [34]

Answer:

Carbon dioxide

Explanation:

6 0
3 years ago
Read 2 more answers
If Gray is dominant over black on flies. What are the 2 possible genotypes of Gray flies?cells
joja [24]

Answer:Gg and Gg

Explanation:G - Grey

g - Black flies

G is dominant over g . GG × gg

3 0
4 years ago
Read 2 more answers
Other questions:
  • Will mark bainliest. Why cells small?<br> Hint becose they small
    12·2 answers
  • Express your opinion about whether or not farmers should continue planting Bt corn. Explain your point of view
    11·1 answer
  • PLEASE HELP- 20 points
    11·2 answers
  • Can u plzzzzz just do any if u know them plz
    8·1 answer
  • Although there is a one in 4 million chance that all of the chromosomes in one parent could come entirely from one grandparent,
    9·1 answer
  • What is photosynyhesis and cellular respiration?
    12·1 answer
  • Consider a cell in which Cl- distributes passively across the membrane according to the membrane potential. The resting membrane
    10·1 answer
  • How do biotic and abiotic factors affect the characteristics of an ecosystem
    6·1 answer
  • What type of cell is autotrophs and heterotrophs
    5·1 answer
  • A sperm cell moves its flagella back and forth in order to move through its environment. Which statement describes how this euka
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!