1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Trava [24]
2 years ago
10

Big Question:How is energy/matter transferred throughout an ecosystem?​

Biology
1 answer:
creativ13 [48]2 years ago
6 0

Answer:

Food webs can transfer energy because the proteins from an animal can go on, this benefits ecosystems.

You might be interested in
Based on this video, the definition for an Invasive Species is a ...
irinina [24]

Answer:

Option 2

Explanation:

I did not see the video referenced, but an invasive species is not always brought by people. Furthermore generally there are no limiting factors because it has no natural predators in the environment and often uses up all the resources in that particular environment. Hope this helps!

8 0
2 years ago
In which specimen were cells first identified
Paha777 [63]
<span>The appropriate response is a cork. The cell was first found and named by Robert Hooke in 1665. He commented that it looked peculiarly like cells or little rooms which friars occupied, in this way determining the name. However what Hooke really observed was the dead cell dividers of plant cells (cork) as it showed up under the magnifying lens.</span>
6 0
3 years ago
Read 2 more answers
What's is in the earth planet
Soloha48 [4]
Oxygen, liquid water, and life is on planet earth
6 0
3 years ago
5. Which of the following statements best describes the response of finches to drought on the Galapagos Islands?
saw5 [17]

Answer:

ob ;]

Explanation:

3 0
3 years ago
Which of the following is an example of a limiting factor in a forest?
Reil [10]

D. Lack of sunlight

Explanation:

In a forest, an example of a limiting factor is that lack of sunlight.

Limiting factors in an ecosystems are the that factors usually made up of environment resources that affects the growth and abundance of organisms in an ecosystem.

  • Examples are sunlight, water, nutrient, air etc
  • In a forest, sunlight is one of the limiting factors.
  • Forest vegetation are stratified.
  • The broad leaved canopy trees dominates and receives the bulk of the sunlight.
  • The undergrowth beneath competes for the little sunlight that reaches below for their own use.
  • Distributions of sunlight in an ecosystem affects the way in which vegetation are dispersed.

learn more:

Rain forest brainly.com/question/12095428

#learnwithBrainly

8 0
3 years ago
Other questions:
  • (Select all that apply.) Why isn't fire considered alive even though it can move and grow?
    13·2 answers
  • Which of the following are not properties of enzymes?
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • You are evaluating a 5-year-old admitted to shadow general hospital with asthma having an acute exacerbation. what would you exp
    7·2 answers
  • Gizmo Warm-up
    9·1 answer
  • As atmospheric CO2 increases, the amount of CO2 dissolved in seawater is expected to increase as well. This produces more carbon
    10·1 answer
  • HELP PLEASE WILL GIVE BRAINLY!! <br><br> What is a complementary RNA strand to TAG?
    8·1 answer
  • Do organisms with the same phenotypes have the same genotypes? Explain.
    8·1 answer
  • The most effective sites for self-stimulation for reward are along the trajectory of the ______________ axons arising in the ven
    10·1 answer
  • What are reactants in the process of photosynthesis
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!