1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex777 [14]
3 years ago
7

Biological pest control involves

Biology
2 answers:
Tom [10]3 years ago
8 0

Answer:

eliminating pests with pesticides

Explanation:

Taya2010 [7]3 years ago
6 0
Uh i looked it up and it says B so whatever B says :)
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Instead of having roots and leaves, molds grow as thread-like filaments called _____.
labwork [276]
Hyphae would be your answer

8 0
3 years ago
Read 2 more answers
PLZ HELP ASAP(giving 80 points):
shusha [124]

Answer:

I hope I can help im so sorry I'm so busy so I can't help thanks for the points tho ✌

8 0
3 years ago
Which scientific investigation has A question procedure and conclusion
Pie
The answer is it's and experiment
5 0
4 years ago
The ming dynasty is known for its
shusha [124]

Many different things for agriculture to architecture. They also where study the stars and worshipped different Gods
6 0
3 years ago
Other questions:
  • What is the difference between saturated fat and unsaturated
    5·1 answer
  • Joyce and Linda are identical twins who are 50 years old and enjoy exercising daily. Joyce avoids eating any dairy or animal pro
    15·2 answers
  • Which organelle in the plant cell would mainly help
    7·2 answers
  • What are some real life examples of a cell membrane?
    8·1 answer
  • Which of the following causes macromolecules to be classified as organic molecules? carbon hydrogen nitrogen oxygen
    13·1 answer
  • The Cell TheoryThe smallest living things are one-celled or ____+_______________Large organisms contain millions of cells. They
    7·1 answer
  • 1/4=0.25=2.5x10 in fractions to decimal value
    11·1 answer
  • List 5 types of evidence used by scientists to support evolution.
    5·1 answer
  • Support or reject the following statement:
    6·1 answer
  • which of the following properties of life was the viking 1 labeled release experiment designed to detect? group of answer choice
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!