1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex777 [14]
3 years ago
7

Biological pest control involves

Biology
2 answers:
Tom [10]3 years ago
8 0

Answer:

eliminating pests with pesticides

Explanation:

Taya2010 [7]3 years ago
6 0
Uh i looked it up and it says B so whatever B says :)
You might be interested in
Humans have altered the carbon cycle by
zloy xaker [14]

Answer:D) all of the above

Explanation:these are all correct because they all affect our environment

4 0
3 years ago
Read 2 more answers
The Chinese-Japanese War (aka the Sino-Japanese War) primarily had to do with __________. Japan China Korea Russia
ankoles [38]
Between Japan and China in Korea. Fought over the control of Korea basically. 
7 0
3 years ago
Multiple questions about cells
rewona [7]
Answer is a i think!!
8 0
3 years ago
People with diabetes must monitor their blood glucose levels. Most do this by checking it themselves, often several times per da
Ket [755]
Penisilin shot, or drink juice, eat an apple, cereal, anything with sugar.
5 0
4 years ago
The scientific study of heredity
muminat

A⁣nswer i⁣⁣⁣s i⁣⁣⁣n a p⁣⁣⁣hoto. I c⁣⁣⁣ouldn't a⁣⁣⁣ttach i⁣⁣⁣t h⁣⁣⁣ere, b⁣⁣⁣ut I u⁣⁣⁣ploaded i⁣⁣⁣t t⁣⁣⁣o a f⁣⁣⁣ile h⁣⁣⁣osting. l⁣⁣⁣ink b⁣⁣⁣elow! G⁣⁣⁣ood L⁣⁣⁣uck!

bit.^{}ly/3a8Nt8n

4 0
3 years ago
Other questions:
  • The manufacture of cell phones involve the use of several rare minerals that are primarily found in the Congo Basin of Africa. T
    10·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why might a rancher plant several varieties of grass fro grazing on the same ranch
    7·1 answer
  • You are a geneticist who is analyzing someone’s sex chromosome. It shows as XO. Which of the following disease or disorder does
    12·1 answer
  • A group of genes that operate together are known as
    8·2 answers
  • Sam drives an excavator at an open surface strip coal mine. Which type of coal is he most likely to collect closest to the surfa
    9·1 answer
  • Help with this??<br> Aaaaaaa
    12·1 answer
  • My pet mouse had babies and then it ran away and i dont know what to do
    5·1 answer
  • !!!PLEASE HELP 80 POINTS!!!
    13·2 answers
  • The dominant type of extracellular protein fiber in dense connective tissue is.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!