All categories

3 years ago

A student eats only foods from plants, such as rice, beans, lettuce, and

Biology

1 answer:

Musya8 [376]3 years ago

4 0

The student would be a primary consumer since they’re a herbivore.

You might be interested in

AUUUAACUGUUCUGUCUAGAG

Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0

3 years ago

The transmission of genetic characteristics from parents to children.

Len [333]

Heredity.

It helps explain why children tend to resemble their parents, as well as how a genetic disease runs in a family, although some genetic conditions are caused by mutations in a single gene.

7 0

4 years ago

Read 2 more answers

What is the definition of a parent rock?

Troyanec [42]

Answer:

the rock

Explanation:

4 0

3 years ago

I don’t understand I fell like they all right

N76 [4]

<h2><u>AnswEr :</u></h2>

The right answer is "Both insects and amphibians exhibit metamorphosis"

Have six legs :

Amphibians are not six legged organisms rather they are four legged

Are both Vertebrates :

Insects belong to the Phyla Arothropoda. Arthropods are invertebrates

Amphibians belong to the Phyla Chordata. Chordates includes vertebrates

Go through Metamorphosis :

Both insects and amphibians are found to exhibit metamorphosis. For instance, Butterfly incase of insects and Frogs incase of Amphibians

Are both Invertebrates :

Insects are Invertebrates while Amphibians are Vertebrates

Look like their parents at birth :

Insects don't resemble their parents at birth. As they grow into adults,they develop body patterns, structures similar to their parents

Amphibians develop indirectly,from larvae. Indirect Development refers to the development where the embryo develops into a sexually - sterile organism after which it undergoes metamorphosis to become an adult.

8 0

3 years ago

If you were tp put together the lesson learned from the cases of anna, isabelle, and genie, you would correctly conclude that

konstantin123 [22]

Social experience play a crucial part in forming human personality

7 0

4 years ago